GEO Profiles Links for Nucleotide (Select 12850976) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 1 to 20 of 47

<< First< Prev

Page of 3

Next >Last >>

Select item 978758221.

2900021C02Rik - Atherosclerosis susceptibility model: macrophages

Annotation:: 2900021C02Rik, RIKEN cDNA 2900021C02 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100090712_TGI_at (ID_REF), GDS4527, AK013565

DataSet type:: Expression profiling by array, count, 20 samples

ID:: 97875822

GEO DataSets Gene Profile neighbors

Select item 971628222.

2900021C02Rik - SmoA1 and SmoA2 models of medulloblastoma: postnatal day 5 brain

Annotation:: 2900021C02Rik, RIKEN cDNA 2900021C02 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100090712_TGI_at (ID_REF), GDS4495, AK013565

DataSet type:: Expression profiling by array, count, 9 samples

ID:: 97162822

GEO DataSets Gene Profile neighbors

Select item 716840363.

2900021C02Rik - Fasting effect on multiple tissues: time course

Annotation:: 2900021C02Rik, RIKEN cDNA 2900021C02 gene

Organism:: Mus musculus

Reporter:: GPL11012, 18536 (ID_REF), GDS3893, AK013565

DataSet type:: Expression profiling by array, log2 ratio, 122 samples

ID:: 71684036

GEO DataSets Gene Profile neighbors

Select item 644824224.

2900021C02Rik - Hypertension model: kidney

Annotation:: 2900021C02Rik, RIKEN cDNA 2900021C02 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100090712_TGI_at (ID_REF), GDS3675, AK013565

DataSet type:: Expression profiling by array, count, 14 samples

ID:: 64482422

GEO DataSets Gene Profile neighbors

Select item 644428225.

2900021C02Rik - Hypertension model: liver

Annotation:: 2900021C02Rik, RIKEN cDNA 2900021C02 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100090712_TGI_at (ID_REF), GDS3674, AK013565

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 64442822

GEO DataSets Gene Profile neighbors

Select item 644032226.

2900021C02Rik - Hypertension model: heart

Annotation:: 2900021C02Rik, RIKEN cDNA 2900021C02 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100090712_TGI_at (ID_REF), GDS3673, AK013565

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 64403222

GEO DataSets Gene Profile neighbors

Select item 643636227.

2900021C02Rik - Hypertension model: aorta

Annotation:: 2900021C02Rik, RIKEN cDNA 2900021C02 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100090712_TGI_at (ID_REF), GDS3672, AK013565

DataSet type:: Expression profiling by array, count, 23 samples

ID:: 64363622

GEO DataSets Gene Profile neighbors

Select item 499554188.

2900021C02Rik - Hepatocyte growth factor effect on Met receptor-knockout primary hepatocytes: time course

Annotation:: 2900021C02Rik, RIKEN cDNA 2900021C02 gene

Organism:: Mus musculus

Reporter:: GPL1536, 1222712_1 (ID_REF), GDS3148, AK013565

DataSet type:: Expression profiling by array, log2 ratio, 60 samples

ID:: 49955418

GEO DataSets Gene Profile neighbors

Select item 215896949.

2900021C02Rik - Embryonic fibroblast-independent embryonic stem cell differentiation

Annotation:: 2900021C02Rik, RIKEN cDNA 2900021C02 gene

Organism:: Mus musculus

Reporter:: GPL1942, 39694 (ID_REF), GDS1882, AK013565

DataSet type:: Expression profiling by array, log2 ratio, 4 samples

ID:: 21589694

GEO DataSets Gene Profile neighbors

Select item 2158969310.

2900021C02Rik - Embryonic fibroblast-independent embryonic stem cell differentiation

Annotation:: 2900021C02Rik, RIKEN cDNA 2900021C02 gene

Organism:: Mus musculus

Reporter:: GPL1942, 39693 (ID_REF), GDS1882, AK013565

DataSet type:: Expression profiling by array, log2 ratio, 4 samples

ID:: 21589693

GEO DataSets Gene Profile neighbors

Select item 762242011.

2900021C02Rik - MPSS analysis of BLK CL.4 and liver cells

Annotation:: 2900021C02Rik, RIKEN cDNA 2900021C02 gene

Organism:: Mus musculus

Reporter:: GPL1010, GATCAGAATCATGAGAAAGA (ID_REF), GDS878, AK013565

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7622420

GEO DataSets Gene

Select item 748472012.

2900021C02Rik - MPSS transcriptome analysis project

Annotation:: 2900021C02Rik, RIKEN cDNA 2900021C02 gene

Organism:: Mus musculus

Reporter:: GPL1010, GATCAGAATCATGAGAAAGA (ID_REF), GDS868, AK013565

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7484720

GEO DataSets Gene

Select item 220640013.

2900021C02Rik - Ligand screen in B cells: untreated

Annotation:: 2900021C02Rik, RIKEN cDNA 2900021C02 gene

Organism:: Mus musculus

Reporter:: GPL260, 2827 (ID_REF), GDS323, AK013565

DataSet type:: Expression profiling by array, log ratio, 41 samples

ID:: 2206400

GEO DataSets Gene

Select item 218960014.

2900021C02Rik - Ligand screen in B cells: tumor necrosis factor-alpha

Annotation:: 2900021C02Rik, RIKEN cDNA 2900021C02 gene

Organism:: Mus musculus

Reporter:: GPL260, 2827 (ID_REF), GDS322, AK013565

DataSet type:: Expression profiling by array, log ratio, 11 samples

ID:: 2189600

GEO DataSets Gene Profile neighbors

Select item 217280015.

2900021C02Rik - Ligand screen in B cells: transforming growth factor-beta

Annotation:: 2900021C02Rik, RIKEN cDNA 2900021C02 gene

Organism:: Mus musculus

Reporter:: GPL260, 2827 (ID_REF), GDS321, AK013565

DataSet type:: Expression profiling by array, log ratio, 9 samples

ID:: 2172800

GEO DataSets Gene Profile neighbors

Select item 215600016.

2900021C02Rik - Ligand screen in B cells: terbutaline

Annotation:: 2900021C02Rik, RIKEN cDNA 2900021C02 gene

Organism:: Mus musculus

Reporter:: GPL260, 2827 (ID_REF), GDS320, AK013565

DataSet type:: Expression profiling by array, log ratio, 12 samples

ID:: 2156000

GEO DataSets Gene Profile neighbors

Select item 213920017.

2900021C02Rik - Ligand screen in B cells: secondary lymphoid-organ chemokine

Annotation:: 2900021C02Rik, RIKEN cDNA 2900021C02 gene

Organism:: Mus musculus

Reporter:: GPL260, 2827 (ID_REF), GDS319, AK013565

DataSet type:: Expression profiling by array, log ratio, 12 samples

ID:: 2139200

GEO DataSets Gene Profile neighbors

Select item 212240018.

2900021C02Rik - Ligand screen in B cells: stromal cell derived factor-1

Annotation:: 2900021C02Rik, RIKEN cDNA 2900021C02 gene

Organism:: Mus musculus

Reporter:: GPL260, 2827 (ID_REF), GDS318, AK013565

DataSet type:: Expression profiling by array, log ratio, 12 samples

ID:: 2122400

GEO DataSets Gene Profile neighbors

Select item 210560019.

2900021C02Rik - Ligand screen in B cells: sphingosine-1-phosphate

Annotation:: 2900021C02Rik, RIKEN cDNA 2900021C02 gene

Organism:: Mus musculus

Reporter:: GPL260, 2827 (ID_REF), GDS317, AK013565

DataSet type:: Expression profiling by array, log ratio, 12 samples

ID:: 2105600

GEO DataSets Gene Profile neighbors

Select item 208880020.

2900021C02Rik - Ligand screen in B cells: prostaglandin E2

Annotation:: 2900021C02Rik, RIKEN cDNA 2900021C02 gene

Organism:: Mus musculus

Reporter:: GPL260, 2827 (ID_REF), GDS316, AK013565

DataSet type:: Expression profiling by array, log ratio, 12 samples

ID:: 2088800

GEO DataSets Gene Profile neighbors

<< First< Prev

Page of 3

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 12850976) (47)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 1 to 20 of 47

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity