GEO Profiles Links for Nucleotide (Select 12851148) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 1 to 20 of 60

<< First< Prev

Page of 3

Next >Last >>

Select item 91909361.

Rab12 - Skeletal muscle response to voluntary running: time course

Annotation:: Rab12, RAB12, member RAS oncogene family

Organism:: Mus musculus

Reporter:: GPL254, 13208 (ID_REF), GDS1019, AK013690

DataSet type:: Expression profiling by array, log ratio, 7 samples

ID:: 9190936

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 75317372.

Rab12 - MPSS transcriptome analysis project

Annotation:: Rab12, RAB12, member RAS oncogene family

Organism:: Mus musculus

Reporter:: GPL1010, GATCCCACCAGAGCTGCCTC (ID_REF), GDS868, AK013690

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7531737

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 183945343.

Rab12 - MyD88-deficient macrophage response to lipopolysaccharide and E. coli (dye swap)

Annotation:: Rab12, RAB12, member RAS oncogene family

Organism:: Mus musculus

Reporter:: GPL1226, 3634 (ID_REF), GDS1706, AK013690

DataSet type:: Expression profiling by array, log2 ratio, 15 samples

ID:: 18394534

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 61487304.

Twsg1 - Blastocyst dormancy and activation comparison

Annotation:: Twsg1, twisted gastrulation BMP signaling modulator 1 (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL870, 12430 (ID_REF), GDS752, AK013690, BC027647, BC029199, BC038883, BC065420, BC004850, H3143E11-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 6 samples

ID:: 6148730

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 285205725.

Rab12 - Guided differentiation into dopaminergic neurons and random differentiation into embryoid bodies

Annotation:: Rab12, RAB12, member RAS oncogene family

Organism:: Mus musculus

Reporter:: GPL2987, 7872 (ID_REF), GDS2227, AK013690

DataSet type:: Expression profiling by array, log ratio, 21 samples

ID:: 28520572

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 76694376.

Rab12 - MPSS analysis of BLK CL.4 and liver cells

Annotation:: Rab12, RAB12, member RAS oncogene family

Organism:: Mus musculus

Reporter:: GPL1010, GATCCCACCAGAGCTGCCTC (ID_REF), GDS878, AK013690

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7669437

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 82365267.

Rab12 - Osteoblasts and microgravity-induced bone loss

Annotation:: Rab12, RAB12, member RAS oncogene family

Organism:: Mus musculus

Reporter:: GPL1219, 2126 (ID_REF), GDS928, AK013690

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 8236526

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 214287288.

Rab12 - Integrin beta-6 deficiency model of emphysema: alveolar macrophage

Annotation:: Rab12, RAB12, member RAS oncogene family

Organism:: Mus musculus

Reporter:: GPL1792, M200004210 (ID_REF), GDS1874, AK013690

DataSet type:: Expression profiling by array, log ratio, 15 samples

ID:: 21428728

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 184094109.

Rab12 - Aldosterone effect on kidney cortical collecting cell line: time course

Annotation:: Rab12, RAB12, member RAS oncogene family

Organism:: Mus musculus

Reporter:: GPL2623, M200004210 (ID_REF), GDS1707, AK013690

DataSet type:: Expression profiling by array, log2 ratio, 8 samples

ID:: 18409410

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 448153010.

Twsg1 - Zygotic gene activation

Annotation:: Twsg1, twisted gastrulation BMP signaling modulator 1 (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL870, 12430 (ID_REF), GDS579, AK013690, BC027647, BC029199, BC038883, BC065420, BC004850, H3143E11-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 36 samples

ID:: 4481530

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 445823011.

Twsg1 - Preimplantation development

Annotation:: Twsg1, twisted gastrulation BMP signaling modulator 1 (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL870, 12430 (ID_REF), GDS578, AK013690, BC027647, BC029199, BC038883, BC065420, BC004850, H3143E11-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 28 samples

ID:: 4458230

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 2257512612.

Rab12 - Various tissues from somatic clones

Annotation:: Rab12, RAB12, member RAS oncogene family

Organism:: Mus musculus

Reporter:: GPL2026, 2126 (ID_REF), GDS1943, AK013690

DataSet type:: Expression profiling by array, count, 36 samples

ID:: 22575126

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11249694313.

Rab12 - Wnt4 mutation effect on female embryonic gonads

Annotation:: Rab12, RAB12, member RAS oncogene family

Organism:: Mus musculus

Reporter:: GPL3108, 6843 (ID_REF), GDS2574, AK013690

DataSet type:: Expression profiling by array, log2 ratio, 4 samples

ID:: 112496943

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1838023414.

Rab12 - MyD88-deficient macrophage response to lipopolysaccharide and E. coli

Annotation:: Rab12, RAB12, member RAS oncogene family

Organism:: Mus musculus

Reporter:: GPL1226, 3634 (ID_REF), GDS1705, AK013690

DataSet type:: Expression profiling by array, log2 ratio, 16 samples

ID:: 18380234

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 2965721615.

Rab12 - Atherogenic diet effect on the liver: time course

Annotation:: Rab12, RAB12, member RAS oncogene family

Organism:: Mus musculus

Reporter:: GPL1292, AGmmA100312 (ID_REF), GDS2292, AK013690

DataSet type:: Expression profiling by array, log10 ratio, 4 samples

ID:: 29657216

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 3957459716.

Rab12 - Wilms' tumor protein Wt1 deficiency effect on the urogenital ridge

Annotation:: Rab12, RAB12, member RAS oncogene family

Organism:: Mus musculus

Reporter:: GPL1524, 2797 (ID_REF), GDS2747, AK013690

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 39574597

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 450393617.

Rab12 - Glomerulonephropathy

Annotation:: Rab12, RAB12, member RAS oncogene family

Organism:: Mus musculus

Reporter:: GPL254, 13208 (ID_REF), GDS580, AK013690

DataSet type:: Expression profiling by array, log ratio, 15 samples

ID:: 4503936

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 892649718.

Rab12 - DNase II and type I interferon receptor double null mutation effect on fetal liver

Annotation:: Rab12, RAB12, member RAS oncogene family

Organism:: Mus musculus

Reporter:: GPL1524, 2797 (ID_REF), GDS996, AK013690

DataSet type:: Expression profiling by array, count, 3 samples

ID:: 8926497

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1303262619.

Rab12 - Testosterone effect on meibomian gland

Annotation:: Rab12, RAB12, member RAS oncogene family

Organism:: Mus musculus

Reporter:: GPL1310, 2126 (ID_REF), GDS1361, AK013690

DataSet type:: Expression profiling by array, transformed count, 18 samples

ID:: 13032626

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2072512620.

Rab12 - Testosterone effect on female lacrimal, meibomian, and submandibular glands

Annotation:: Rab12, RAB12, member RAS oncogene family

Organism:: Mus musculus

Reporter:: GPL1310, 2126 (ID_REF), GDS1832, AK013690

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 20725126

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 3

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 12851148) (60)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 1 to 20 of 60

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity