GEO Profiles Links for Nucleotide (Select 12851510) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 1 to 20 of 47

<< First< Prev

Page of 3

Next >Last >>

Select item 214332291.

Paqr8 - Integrin beta-6 deficiency model of emphysema: alveolar macrophage

Annotation:: Paqr8, progestin and adipoQ receptor family member VIII

Organism:: Mus musculus

Reporter:: GPL1792, M200008711 (ID_REF), GDS1874, AK013938

DataSet type:: Expression profiling by array, log ratio, 15 samples

ID:: 21433229

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 716802122.

Paqr8 - Fasting effect on multiple tissues: time course

Annotation:: Paqr8, progestin and adipoQ receptor family member VIII

Organism:: Mus musculus

Reporter:: GPL11012, 14712 (ID_REF), GDS3893, AK013938

DataSet type:: Expression profiling by array, log2 ratio, 122 samples

ID:: 71680212

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 499623793.

Paqr8 - Hepatocyte growth factor effect on Met receptor-knockout primary hepatocytes: time course

Annotation:: Paqr8, progestin and adipoQ receptor family member VIII

Organism:: Mus musculus

Reporter:: GPL1536, 1222854_1 (ID_REF), GDS3148, AK013938

DataSet type:: Expression profiling by array, log2 ratio, 60 samples

ID:: 49962379

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 184139114.

Paqr8 - Aldosterone effect on kidney cortical collecting cell line: time course

Annotation:: Paqr8, progestin and adipoQ receptor family member VIII

Organism:: Mus musculus

Reporter:: GPL2623, M200008711 (ID_REF), GDS1707, AK013938

DataSet type:: Expression profiling by array, log2 ratio, 8 samples

ID:: 18413911

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 46377795.

Paqr8 - Large-scale analysis of the mouse transcriptome (GNF1M)

Annotation:: Paqr8, progestin and adipoQ receptor family member VIII

Organism:: Mus musculus

Reporter:: GPL1073, gnf1m13515_at (ID_REF), GDS592, AK013938

DataSet type:: Expression profiling by array, count, 122 samples

ID:: 4637779

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10529296.

Paqr8 - Platform type/amplification method cross comparison (16K cDNA)(II)

Annotation:: Paqr8, progestin and adipoQ receptor family member VIII

Organism:: Mus musculus

Reporter:: GPL260, 1366 (ID_REF), GDS225, AK013938

DataSet type:: Expression profiling by array, log ratio, 6 samples

ID:: 1052929

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 21715297.

Paqr8 - Ligand screen in B cells: transforming growth factor-beta

Annotation:: Paqr8, progestin and adipoQ receptor family member VIII

Organism:: Mus musculus

Reporter:: GPL260, 1366 (ID_REF), GDS321, AK013938

DataSet type:: Expression profiling by array, log ratio, 9 samples

ID:: 2171529

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1124987488.

Paqr8 - Wnt4 mutation effect on female embryonic gonads

Annotation:: Paqr8, progestin and adipoQ receptor family member VIII

Organism:: Mus musculus

Reporter:: GPL3108, 8648 (ID_REF), GDS2574, AK013938

DataSet type:: Expression profiling by array, log2 ratio, 4 samples

ID:: 112498748

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10361299.

Paqr8 - Platform type/amplification method cross comparison (16K cDNA)(I)

Annotation:: Paqr8, progestin and adipoQ receptor family member VIII

Organism:: Mus musculus

Reporter:: GPL260, 1366 (ID_REF), GDS224, AK013938

DataSet type:: Expression profiling by array, log ratio, 6 samples

ID:: 1036129

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 180192910.

Paqr8 - Ligand screen in B cells: CpG-oligodeoxynucleotide

Annotation:: Paqr8, progestin and adipoQ receptor family member VIII

Organism:: Mus musculus

Reporter:: GPL260, 1366 (ID_REF), GDS299, AK013938

DataSet type:: Expression profiling by array, log ratio, 12 samples

ID:: 1801929

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 748976611.

Paqr8 - MPSS transcriptome analysis project

Annotation:: Paqr8, progestin and adipoQ receptor family member VIII

Organism:: Mus musculus

Reporter:: GPL1010, GATCTGTGTTTTGCTTGGTT (ID_REF), GDS868, AK013938

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7489766

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 171792912.

Paqr8 - Ligand screen in B cells: B-lymphocyte chemoattractant

Annotation:: Paqr8, progestin and adipoQ receptor family member VIII

Organism:: Mus musculus

Reporter:: GPL260, 1366 (ID_REF), GDS294, AK013938

DataSet type:: Expression profiling by array, log ratio, 11 samples

ID:: 1717929

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 191952913.

Paqr8 - Ligand screen in B cells: insulin-like growth factor 1

Annotation:: Paqr8, progestin and adipoQ receptor family member VIII

Organism:: Mus musculus

Reporter:: GPL260, 1366 (ID_REF), GDS306, AK013938

DataSet type:: Expression profiling by array, log ratio, 12 samples

ID:: 1919529

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 212112914.

Paqr8 - Ligand screen in B cells: stromal cell derived factor-1

Annotation:: Paqr8, progestin and adipoQ receptor family member VIII

Organism:: Mus musculus

Reporter:: GPL260, 1366 (ID_REF), GDS318, AK013938

DataSet type:: Expression profiling by array, log ratio, 12 samples

ID:: 2121129

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2158169615.

Paqr8 - Embryonic fibroblast-independent embryonic stem cell differentiation

Annotation:: Paqr8, progestin and adipoQ receptor family member VIII

Organism:: Mus musculus

Reporter:: GPL1942, 31696 (ID_REF), GDS1882, AK013938

DataSet type:: Expression profiling by array, log2 ratio, 4 samples

ID:: 21581696

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 220512916.

Paqr8 - Ligand screen in B cells: untreated

Annotation:: Paqr8, progestin and adipoQ receptor family member VIII

Organism:: Mus musculus

Reporter:: GPL260, 1366 (ID_REF), GDS323, AK013938

DataSet type:: Expression profiling by array, log ratio, 41 samples

ID:: 2205129

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2585118217.

Paqr8 - Developing mammary gland: terminal end buds and ducts

Annotation:: Paqr8, progestin and adipoQ receptor family member VIII

Organism:: Mus musculus

Reporter:: GPL2660, 182 (ID_REF), GDS2115, AK013938

DataSet type:: Expression profiling by array, log2 ratio, 12 samples

ID:: 25851182

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 3030427918.

Paqr8 - Transgenic T-cell receptor model of tolerant CD8+ T cells

Annotation:: Paqr8, progestin and adipoQ receptor family member VIII

Organism:: Mus musculus

Reporter:: GPL1073, gnf1m13515_at (ID_REF), GDS2327, AK013938

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 30304279

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 181872919.

Paqr8 - Ligand screen in B cells: dimaprit

Annotation:: Paqr8, progestin and adipoQ receptor family member VIII

Organism:: Mus musculus

Reporter:: GPL260, 1366 (ID_REF), GDS300, AK013938

DataSet type:: Expression profiling by array, log ratio, 12 samples

ID:: 1818729

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 215472920.

Paqr8 - Ligand screen in B cells: terbutaline

Annotation:: Paqr8, progestin and adipoQ receptor family member VIII

Organism:: Mus musculus

Reporter:: GPL260, 1366 (ID_REF), GDS320, AK013938

DataSet type:: Expression profiling by array, log ratio, 12 samples

ID:: 2154729

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 3

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 12851510) (47)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 1 to 20 of 47

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity