GEO Profiles Links for Nucleotide (Select 12851631) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 1 to 20 of 41

<< First< Prev

Page of 3

Next >Last >>

Select item 716743931.

3110006O06Rik - Fasting effect on multiple tissues: time course

Annotation:: 3110006O06Rik, RIKEN cDNA 3110006O06 gene

Organism:: Mus musculus

Reporter:: GPL11012, 8893 (ID_REF), GDS3893, AK014014

DataSet type:: Expression profiling by array, log2 ratio, 122 samples

ID:: 71674393

GEO DataSets Gene

Select item 499582852.

3110006O06Rik - Hepatocyte growth factor effect on Met receptor-knockout primary hepatocytes: time course

Annotation:: 3110006O06Rik, RIKEN cDNA 3110006O06 gene

Organism:: Mus musculus

Reporter:: GPL1536, 1220487_1 (ID_REF), GDS3148, AK014014

DataSet type:: Expression profiling by array, log2 ratio, 60 samples

ID:: 49958285

GEO DataSets Gene Profile neighbors

Select item 215930323.

3110006O06Rik - Embryonic fibroblast-independent embryonic stem cell differentiation

Annotation:: 3110006O06Rik, RIKEN cDNA 3110006O06 gene

Organism:: Mus musculus

Reporter:: GPL1942, 43032 (ID_REF), GDS1882, AK014014

DataSet type:: Expression profiling by array, log2 ratio, 4 samples

ID:: 21593032

GEO DataSets Gene Profile neighbors

Select item 215930314.

3110006O06Rik - Embryonic fibroblast-independent embryonic stem cell differentiation

Annotation:: 3110006O06Rik, RIKEN cDNA 3110006O06 gene

Organism:: Mus musculus

Reporter:: GPL1942, 43031 (ID_REF), GDS1882, AK014014

DataSet type:: Expression profiling by array, log2 ratio, 4 samples

ID:: 21593031

GEO DataSets Gene Profile neighbors

Select item 76272275.

3110006O06Rik - MPSS analysis of BLK CL.4 and liver cells

Annotation:: 3110006O06Rik, RIKEN cDNA 3110006O06 gene

Organism:: Mus musculus

Reporter:: GPL1010, GATCCCGACTCCTCTGCGGC (ID_REF), GDS878, AK014014

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7627227

GEO DataSets Gene

Select item 74895276.

3110006O06Rik - MPSS transcriptome analysis project

Annotation:: 3110006O06Rik, RIKEN cDNA 3110006O06 gene

Organism:: Mus musculus

Reporter:: GPL1010, GATCCCGACTCCTCTGCGGC (ID_REF), GDS868, AK014014

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7489527

GEO DataSets Gene

Select item 22146217.

3110006O06Rik - Ligand screen in B cells: untreated

Annotation:: 3110006O06Rik, RIKEN cDNA 3110006O06 gene

Organism:: Mus musculus

Reporter:: GPL260, 12315 (ID_REF), GDS323, AK014014

DataSet type:: Expression profiling by array, log ratio, 41 samples

ID:: 2214621

GEO DataSets Gene

Select item 21978218.

3110006O06Rik - Ligand screen in B cells: tumor necrosis factor-alpha

Annotation:: 3110006O06Rik, RIKEN cDNA 3110006O06 gene

Organism:: Mus musculus

Reporter:: GPL260, 12315 (ID_REF), GDS322, AK014014

DataSet type:: Expression profiling by array, log ratio, 11 samples

ID:: 2197821

GEO DataSets Gene Profile neighbors

Select item 21810219.

3110006O06Rik - Ligand screen in B cells: transforming growth factor-beta

Annotation:: 3110006O06Rik, RIKEN cDNA 3110006O06 gene

Organism:: Mus musculus

Reporter:: GPL260, 12315 (ID_REF), GDS321, AK014014

DataSet type:: Expression profiling by array, log ratio, 9 samples

ID:: 2181021

GEO DataSets Gene Profile neighbors

Select item 216422110.

3110006O06Rik - Ligand screen in B cells: terbutaline

Annotation:: 3110006O06Rik, RIKEN cDNA 3110006O06 gene

Organism:: Mus musculus

Reporter:: GPL260, 12315 (ID_REF), GDS320, AK014014

DataSet type:: Expression profiling by array, log ratio, 12 samples

ID:: 2164221

GEO DataSets Gene Profile neighbors

Select item 214742111.

3110006O06Rik - Ligand screen in B cells: secondary lymphoid-organ chemokine

Annotation:: 3110006O06Rik, RIKEN cDNA 3110006O06 gene

Organism:: Mus musculus

Reporter:: GPL260, 12315 (ID_REF), GDS319, AK014014

DataSet type:: Expression profiling by array, log ratio, 12 samples

ID:: 2147421

GEO DataSets Gene Profile neighbors

Select item 213062112.

3110006O06Rik - Ligand screen in B cells: stromal cell derived factor-1

Annotation:: 3110006O06Rik, RIKEN cDNA 3110006O06 gene

Organism:: Mus musculus

Reporter:: GPL260, 12315 (ID_REF), GDS318, AK014014

DataSet type:: Expression profiling by array, log ratio, 12 samples

ID:: 2130621

GEO DataSets Gene Profile neighbors

Select item 211382113.

3110006O06Rik - Ligand screen in B cells: sphingosine-1-phosphate

Annotation:: 3110006O06Rik, RIKEN cDNA 3110006O06 gene

Organism:: Mus musculus

Reporter:: GPL260, 12315 (ID_REF), GDS317, AK014014

DataSet type:: Expression profiling by array, log ratio, 12 samples

ID:: 2113821

GEO DataSets Gene Profile neighbors

Select item 209702114.

3110006O06Rik - Ligand screen in B cells: prostaglandin E2

Annotation:: 3110006O06Rik, RIKEN cDNA 3110006O06 gene

Organism:: Mus musculus

Reporter:: GPL260, 12315 (ID_REF), GDS316, AK014014

DataSet type:: Expression profiling by array, log ratio, 12 samples

ID:: 2097021

GEO DataSets Gene Profile neighbors

Select item 208022115.

3110006O06Rik - Ligand screen in B cells: platelet activating factor

Annotation:: 3110006O06Rik, RIKEN cDNA 3110006O06 gene

Organism:: Mus musculus

Reporter:: GPL260, 12315 (ID_REF), GDS315, AK014014

DataSet type:: Expression profiling by array, log ratio, 11 samples

ID:: 2080221

GEO DataSets Gene Profile neighbors

Select item 206342116.

3110006O06Rik - Ligand screen in B cells: neuropeptide Y

Annotation:: 3110006O06Rik, RIKEN cDNA 3110006O06 gene

Organism:: Mus musculus

Reporter:: GPL260, 12315 (ID_REF), GDS314, AK014014

DataSet type:: Expression profiling by array, log ratio, 11 samples

ID:: 2063421

GEO DataSets Gene Profile neighbors

Select item 204662117.

3110006O06Rik - Ligand screen in B cells: nerve growth factor

Annotation:: 3110006O06Rik, RIKEN cDNA 3110006O06 gene

Organism:: Mus musculus

Reporter:: GPL260, 12315 (ID_REF), GDS313, AK014014

DataSet type:: Expression profiling by array, log ratio, 12 samples

ID:: 2046621

GEO DataSets Gene Profile neighbors

Select item 202982118.

3110006O06Rik - Ligand screen in B cells: macrophage inflammatory protein-3

Annotation:: 3110006O06Rik, RIKEN cDNA 3110006O06 gene

Organism:: Mus musculus

Reporter:: GPL260, 12315 (ID_REF), GDS312, AK014014

DataSet type:: Expression profiling by array, log ratio, 12 samples

ID:: 2029821

GEO DataSets Gene Profile neighbors

Select item 201302119.

3110006O06Rik - Ligand screen in B cells: leukotriene B4

Annotation:: 3110006O06Rik, RIKEN cDNA 3110006O06 gene

Organism:: Mus musculus

Reporter:: GPL260, 12315 (ID_REF), GDS311, AK014014

DataSet type:: Expression profiling by array, log ratio, 12 samples

ID:: 2013021

GEO DataSets Gene Profile neighbors

Select item 199622120.

3110006O06Rik - Ligand screen in B cells: lipopolysaccharide

Annotation:: 3110006O06Rik, RIKEN cDNA 3110006O06 gene

Organism:: Mus musculus

Reporter:: GPL260, 12315 (ID_REF), GDS310, AK014014

DataSet type:: Expression profiling by array, log ratio, 12 samples

ID:: 1996221

GEO DataSets Gene Profile neighbors

<< First< Prev

Page of 3

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 12851631) (41)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 1 to 20 of 41

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity