GEO Profiles Links for Nucleotide (Select 12859440) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 1 to 20 of 47

<< First< Prev

Page of 3

Next >Last >>

Select item 18409341.

2900002H24Rik - Ligand screen in B cells: Epstein Barr virus-induced molecule-1

Annotation:: 2900002H24Rik, RIKEN cDNA 2900002H24 gene

Organism:: Mus musculus

Reporter:: GPL260, 7597 (ID_REF), GDS301, AK019300

DataSet type:: Expression profiling by array, log ratio, 11 samples

ID:: 1840934

GEO DataSets Gene Profile neighbors

Select item 10583342.

2900002H24Rik - Platform type/amplification method cross comparison (16K cDNA)(II)

Annotation:: 2900002H24Rik, RIKEN cDNA 2900002H24 gene

Organism:: Mus musculus

Reporter:: GPL260, 7597 (ID_REF), GDS225, AK019300

DataSet type:: Expression profiling by array, log ratio, 6 samples

ID:: 1058334

GEO DataSets Gene Profile neighbors

Select item 21601343.

2900002H24Rik - Ligand screen in B cells: terbutaline

Annotation:: 2900002H24Rik, RIKEN cDNA 2900002H24 gene

Organism:: Mus musculus

Reporter:: GPL260, 7597 (ID_REF), GDS320, AK019300

DataSet type:: Expression profiling by array, log ratio, 12 samples

ID:: 2160134

GEO DataSets Gene Profile neighbors

Select item 19081344.

2900002H24Rik - Ligand screen in B cells: interferon gamma

Annotation:: 2900002H24Rik, RIKEN cDNA 2900002H24 gene

Organism:: Mus musculus

Reporter:: GPL260, 7597 (ID_REF), GDS305, AK019300

DataSet type:: Expression profiling by array, log ratio, 12 samples

ID:: 1908134

GEO DataSets Gene Profile neighbors

Select item 20929345.

2900002H24Rik - Ligand screen in B cells: prostaglandin E2

Annotation:: 2900002H24Rik, RIKEN cDNA 2900002H24 gene

Organism:: Mus musculus

Reporter:: GPL260, 7597 (ID_REF), GDS316, AK019300

DataSet type:: Expression profiling by array, log ratio, 12 samples

ID:: 2092934

GEO DataSets Gene Profile neighbors

Select item 18745346.

2900002H24Rik - Ligand screen in B cells: growth hormone releasing hormone

Annotation:: 2900002H24Rik, RIKEN cDNA 2900002H24 gene

Organism:: Mus musculus

Reporter:: GPL260, 7597 (ID_REF), GDS303, AK019300

DataSet type:: Expression profiling by array, log ratio, 12 samples

ID:: 1874534

GEO DataSets Gene Profile neighbors

Select item 75048797.

2900002H24Rik - MPSS transcriptome analysis project

Annotation:: 2900002H24Rik, RIKEN cDNA 2900002H24 gene

Organism:: Mus musculus

Reporter:: GPL1010, GATCCTGAGGCTTTCTGACT (ID_REF), GDS868, AK019300

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7504879

GEO DataSets Gene

Select item 21097348.

2900002H24Rik - Ligand screen in B cells: sphingosine-1-phosphate

Annotation:: 2900002H24Rik, RIKEN cDNA 2900002H24 gene

Organism:: Mus musculus

Reporter:: GPL260, 7597 (ID_REF), GDS317, AK019300

DataSet type:: Expression profiling by array, log ratio, 12 samples

ID:: 2109734

GEO DataSets Gene Profile neighbors

Select item 19249349.

2900002H24Rik - Ligand screen in B cells: insulin-like growth factor 1

Annotation:: 2900002H24Rik, RIKEN cDNA 2900002H24 gene

Organism:: Mus musculus

Reporter:: GPL260, 7597 (ID_REF), GDS306, AK019300

DataSet type:: Expression profiling by array, log ratio, 12 samples

ID:: 1924934

GEO DataSets Gene Profile neighbors

Select item 221053410.

2900002H24Rik - Ligand screen in B cells: untreated

Annotation:: 2900002H24Rik, RIKEN cDNA 2900002H24 gene

Organism:: Mus musculus

Reporter:: GPL260, 7597 (ID_REF), GDS323, AK019300

DataSet type:: Expression profiling by array, log ratio, 41 samples

ID:: 2210534

GEO DataSets Gene

Select item 104153411.

2900002H24Rik - Platform type/amplification method cross comparison (16K cDNA)(I)

Annotation:: 2900002H24Rik, RIKEN cDNA 2900002H24 gene

Organism:: Mus musculus

Reporter:: GPL260, 7597 (ID_REF), GDS224, AK019300

DataSet type:: Expression profiling by array, log ratio, 6 samples

ID:: 1041534

GEO DataSets Gene Profile neighbors

Select item 195853412.

2900002H24Rik - Ligand screen in B cells: interleukin 10

Annotation:: 2900002H24Rik, RIKEN cDNA 2900002H24 gene

Organism:: Mus musculus

Reporter:: GPL260, 7597 (ID_REF), GDS308, AK019300

DataSet type:: Expression profiling by array, log ratio, 11 samples

ID:: 1958534

GEO DataSets Gene Profile neighbors

Select item 167293413.

2900002H24Rik - Ligand screen in B cells: 2-methyl-thio-ATP

Annotation:: 2900002H24Rik, RIKEN cDNA 2900002H24 gene

Organism:: Mus musculus

Reporter:: GPL260, 7597 (ID_REF), GDS291, AK019300

DataSet type:: Expression profiling by array, log ratio, 11 samples

ID:: 1672934

GEO DataSets Gene Profile neighbors

Select item 202573414.

2900002H24Rik - Ligand screen in B cells: macrophage inflammatory protein-3

Annotation:: 2900002H24Rik, RIKEN cDNA 2900002H24 gene

Organism:: Mus musculus

Reporter:: GPL260, 7597 (ID_REF), GDS312, AK019300

DataSet type:: Expression profiling by array, log ratio, 12 samples

ID:: 2025734

GEO DataSets Gene Profile neighbors

Select item 175693415.

2900002H24Rik - Ligand screen in B cells: CD27

Annotation:: 2900002H24Rik, RIKEN cDNA 2900002H24 gene

Organism:: Mus musculus

Reporter:: GPL260, 7597 (ID_REF), GDS296, AK019300

DataSet type:: Expression profiling by array, log ratio, 12 samples

ID:: 1756934

GEO DataSets Gene Profile neighbors

Select item 199213416.

2900002H24Rik - Ligand screen in B cells: lipopolysaccharide

Annotation:: 2900002H24Rik, RIKEN cDNA 2900002H24 gene

Organism:: Mus musculus

Reporter:: GPL260, 7597 (ID_REF), GDS310, AK019300

DataSet type:: Expression profiling by array, log ratio, 12 samples

ID:: 1992134

GEO DataSets Gene Profile neighbors

Select item 205933417.

2900002H24Rik - Ligand screen in B cells: neuropeptide Y

Annotation:: 2900002H24Rik, RIKEN cDNA 2900002H24 gene

Organism:: Mus musculus

Reporter:: GPL260, 7597 (ID_REF), GDS314, AK019300

DataSet type:: Expression profiling by array, log ratio, 11 samples

ID:: 2059334

GEO DataSets Gene Profile neighbors

Select item 219373418.

2900002H24Rik - Ligand screen in B cells: tumor necrosis factor-alpha

Annotation:: 2900002H24Rik, RIKEN cDNA 2900002H24 gene

Organism:: Mus musculus

Reporter:: GPL260, 7597 (ID_REF), GDS322, AK019300

DataSet type:: Expression profiling by array, log ratio, 11 samples

ID:: 2193734

GEO DataSets Gene Profile neighbors

Select item 204253419.

2900002H24Rik - Ligand screen in B cells: nerve growth factor

Annotation:: 2900002H24Rik, RIKEN cDNA 2900002H24 gene

Organism:: Mus musculus

Reporter:: GPL260, 7597 (ID_REF), GDS313, AK019300

DataSet type:: Expression profiling by array, log ratio, 12 samples

ID:: 2042534

GEO DataSets Gene Profile neighbors

Select item 174013420.

2900002H24Rik - Ligand screen in B cells: bombesin

Annotation:: 2900002H24Rik, RIKEN cDNA 2900002H24 gene

Organism:: Mus musculus

Reporter:: GPL260, 7597 (ID_REF), GDS295, AK019300

DataSet type:: Expression profiling by array, log ratio, 11 samples

ID:: 1740134

GEO DataSets Gene Profile neighbors

<< First< Prev

Page of 3

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 12859440) (47)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 1 to 20 of 47

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity