GEO Profiles Links for Nucleotide (Select 18605854) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 16

Select item 44554311.

Colgalt1 - Preimplantation development

Annotation:: Colgalt1, collagen beta(1-O)galactosyltransferase 1 (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL870, 9631 (ID_REF), GDS578, AK027952, AK088758, BC006036, BC023167, BC023721, BC048188, BC049800, BC034208, H3084C07-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 28 samples

ID:: 4455431

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 44787312.

Colgalt1 - Zygotic gene activation

Annotation:: Colgalt1, collagen beta(1-O)galactosyltransferase 1 (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL870, 9631 (ID_REF), GDS579, AK027952, AK088758, BC006036, BC023167, BC023721, BC048188, BC049800, BC034208, H3084C07-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 36 samples

ID:: 4478731

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 1125160123.

Hmgxb4 - Irradiation effect on peripheral blood mononuclear cells: dose response

Annotation:: Hmgxb4, HMG box domain containing 4

Organism:: Mus musculus

Reporter:: GPL4783, M200013423 (ID_REF), GDS2645, BC023167

DataSet type:: Expression profiling by array, log2 ratio, 28 samples

ID:: 112516012

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 214379414.

Hmgxb4 - Integrin beta-6 deficiency model of emphysema: alveolar macrophage

Annotation:: Hmgxb4, HMG box domain containing 4

Organism:: Mus musculus

Reporter:: GPL1792, M200013423 (ID_REF), GDS1874, BC023167

DataSet type:: Expression profiling by array, log ratio, 15 samples

ID:: 21437941

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 184186235.

Hmgxb4 - Aldosterone effect on kidney cortical collecting cell line: time course

Annotation:: Hmgxb4, HMG box domain containing 4

Organism:: Mus musculus

Reporter:: GPL2623, M200013423 (ID_REF), GDS1707, BC023167

DataSet type:: Expression profiling by array, log2 ratio, 8 samples

ID:: 18418623

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 296722936.

Hmgxb4 - Atherogenic diet effect on the liver: time course

Annotation:: Hmgxb4, HMG box domain containing 4

Organism:: Mus musculus

Reporter:: GPL1292, AGmmB230717 (ID_REF), GDS2292, BC023167

DataSet type:: Expression profiling by array, log10 ratio, 4 samples

ID:: 29672293

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 258660257.

Hmgxb4 - Developing mammary gland: terminal end buds and ducts

Annotation:: Hmgxb4, HMG box domain containing 4

Organism:: Mus musculus

Reporter:: GPL2660, 15025 (ID_REF), GDS2115, BC023167

DataSet type:: Expression profiling by array, log2 ratio, 12 samples

ID:: 25866025

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 61396028.

Colgalt1 - Blastocyst dormancy and activation comparison

Annotation:: Colgalt1, collagen beta(1-O)galactosyltransferase 1 (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL870, 3302 (ID_REF), GDS752, AK027952, AK088758, BC006036, BC023167, BC023721, BC048188, BC049800, BC034208, C0632H08-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 6 samples

ID:: 6139602

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 459708419.

Hmgxb4 - Hepatoerythropoietic porphyria model

Annotation:: Hmgxb4, HMG box domain containing 4

Organism:: Danio rerio

Reporter:: GPL5692, mwgzebrafish#08328 (ID_REF), GDS2991, BC023167

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 45970841

GEO DataSets Gene Profile neighbors Homologene neighbors

Select item 614593110.

Colgalt1 - Blastocyst dormancy and activation comparison

Annotation:: Colgalt1, collagen beta(1-O)galactosyltransferase 1 (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL870, 9631 (ID_REF), GDS752, AK027952, AK088758, BC006036, BC023167, BC023721, BC048188, BC049800, BC034208, H3084C07-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 6 samples

ID:: 6145931

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 746603511.

Hmgxb4 - MPSS transcriptome analysis project

Annotation:: Hmgxb4, HMG box domain containing 4

Organism:: Mus musculus

Reporter:: GPL1010, GATCTTGGGAGGAGGCCAGC (ID_REF), GDS868, BC023167

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7466035

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 11250354512.

Hmgxb4 - Wnt4 mutation effect on female embryonic gonads

Annotation:: Hmgxb4, HMG box domain containing 4

Organism:: Mus musculus

Reporter:: GPL3108, 13445 (ID_REF), GDS2574, BC023167

DataSet type:: Expression profiling by array, log2 ratio, 4 samples

ID:: 112503545

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 444910213.

Colgalt1 - Preimplantation development

Annotation:: Colgalt1, collagen beta(1-O)galactosyltransferase 1 (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL870, 3302 (ID_REF), GDS578, AK027952, AK088758, BC006036, BC023167, BC023721, BC048188, BC049800, BC034208, C0632H08-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 28 samples

ID:: 4449102

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 2064112114.

Hmgxb4 - Adenovirus vector effect on complement system deficient mutant livers

Annotation:: Hmgxb4, HMG box domain containing 4

Organism:: Mus musculus

Reporter:: GPL3222, M200013423 (ID_REF), GDS1826, BC023167

DataSet type:: Expression profiling by array, log2 ratio, 29 samples

ID:: 20641121

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 447240215.

Colgalt1 - Zygotic gene activation

Annotation:: Colgalt1, collagen beta(1-O)galactosyltransferase 1 (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL870, 3302 (ID_REF), GDS579, AK027952, AK088758, BC006036, BC023167, BC023721, BC048188, BC049800, BC034208, C0632H08-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 36 samples

ID:: 4472402

GEO DataSets Gene Chromosome neighbors

Select item 760373516.

Hmgxb4 - MPSS analysis of BLK CL.4 and liver cells

Annotation:: Hmgxb4, HMG box domain containing 4

Organism:: Mus musculus

Reporter:: GPL1010, GATCTTGGGAGGAGGCCAGC (ID_REF), GDS878, BC023167

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7603735

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 18605854) (16)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 16

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity