GEO Profiles Links for Nucleotide (Select 201107) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 1 to 20 of 468

<< First< Prev

Page of 24

Next >Last >>

Select item 59379671.

Cidec - Thiazolidinedione treatment of 3T3-L1 adipocytes

Annotation:: Cidec, cell death-inducing DFFA-like effector c

Organism:: Mus musculus

Reporter:: GPL81, 102016_at (ID_REF), GDS734, 14311 (Gene ID), M61737

DataSet type:: Expression profiling by array, count, 11 samples

ID:: 5937967

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1181673392.

Cidec - Age effect on adipocytes of the bone marrow and epididymis

Annotation:: Cidec, cell death-inducing DFFA-like effector c

Organism:: Mus musculus

Reporter:: GPL6246, 10546929 (ID_REF), GDS5226, NM_178373, BC099676, M61737, chr6:113424634-113435755 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 18 samples

ID:: 118167339

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1318753393.

Cidec - Short-term high fat diet effect on epididymal adipose fractions: time course

Annotation:: Cidec, cell death-inducing DFFA-like effector c

Organism:: Mus musculus

Reporter:: GPL6246, 10546929 (ID_REF), GDS5824, NM_178373, BC099676, M61737, chr6:113424634-113435755 (SPOT ID)

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 131875339

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 117660674.

Cidec - Fibroblast adipogenesis induced by EBF-1 and PPARgamma2 overexpression: time course

Annotation:: Cidec, cell death-inducing DFFA-like effector c

Organism:: Mus musculus

Reporter:: GPL81, 102016_at (ID_REF), GDS1298, 14311 (Gene ID), M61737

DataSet type:: Expression profiling by array, count, 53 samples

ID:: 11766067

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 74732965.

Cidec - MPSS transcriptome analysis project

Annotation:: Cidec, cell death-inducing DFFA-like effector c

Organism:: Mus musculus

Reporter:: GPL1010, GATCTGGGGGGTCCTCACCT (ID_REF), GDS868, M61737

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7473296

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 414418676.

Cidec - Adipocytes and preadipocytes from subcutaneous and visceral fat depots

Annotation:: Cidec, cell death-inducing DFFA-like effector c

Organism:: Mus musculus

Reporter:: GPL81, 102016_at (ID_REF), GDS2818, 14311 (Gene ID), M61737

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 41441867

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 105775677.

Cidec - White adipose tissue remodeling: response to β3-adrenergic receptor activation

Annotation:: Cidec, cell death-inducing DFFA-like effector c

Organism:: Mus musculus

Reporter:: GPL81, 102016_at (ID_REF), GDS1225, 14311 (Gene ID), M61737

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 10577567

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 105904678.

Cidec - White adipose tissue remodeling: role of peroxisome proliferator-activated receptor alpha

Annotation:: Cidec, cell death-inducing DFFA-like effector c

Organism:: Mus musculus

Reporter:: GPL81, 102016_at (ID_REF), GDS1226, 14311 (Gene ID), M61737

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 10590467

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 927748399.

Cidec - Neurofibromin inactivation effect on triceps muscle

Annotation:: Cidec, cell death-inducing DFFA-like effector c

Organism:: Mus musculus

Reporter:: GPL6246, 10546929 (ID_REF), GDS4447, NM_178373, BC099676, M61737, chr6:113424634-113435755 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 92774839

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11408983910.

Cidec - Gain-of-function model for conditional activation of IKK2/NF-κB in pancreatic beta-cells

Annotation:: Cidec, cell death-inducing DFFA-like effector c

Organism:: Mus musculus

Reporter:: GPL6246, 10546929 (ID_REF), GDS4933, NM_178373, BC099676, M61737, chr6:113424634-113435755 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 14 samples

ID:: 114089839

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 5842336711.

Cidec - Adipose tissue response to dihydrotestosterone: time course

Annotation:: Cidec, cell death-inducing DFFA-like effector c

Organism:: Mus musculus

Reporter:: GPL81, 102016_at (ID_REF), GDS3488, 14311 (Gene ID), M61737

DataSet type:: Expression profiling by array, count, 16 samples

ID:: 58423367

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1451030212.

Cidec - Obesity and type 2 diabetes: role of adipogenic gene expression (Mu11K-B)

Annotation:: Cidec, cell death-inducing DFFA-like effector c

Organism:: Mus musculus

Reporter:: GPL76, Msa.1197.0_s_at (ID_REF), GDS1456, M61737

DataSet type:: Expression profiling by array, count, 11 samples

ID:: 14510302

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 3742620213.

Cidec - Various adult tissues (Mu11K-B)

Annotation:: Cidec, cell death-inducing DFFA-like effector c

Organism:: Mus musculus

Reporter:: GPL76, Msa.1197.0_s_at (ID_REF), GDS2662, M61737

DataSet type:: Expression profiling by array, count, 5 samples

ID:: 37426202

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 3741260214.

Cidec - Adipogenesis in vitro (Mu11K-B)

Annotation:: Cidec, cell death-inducing DFFA-like effector c

Organism:: Mus musculus

Reporter:: GPL76, Msa.1197.0_s_at (ID_REF), GDS2660, M61737

DataSet type:: Expression profiling by array, count, 10 samples

ID:: 37412602

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4211016715.

Cidec - Mammary gland development

Annotation:: Cidec, cell death-inducing DFFA-like effector c

Organism:: Mus musculus

Reporter:: GPL81, 102016_at (ID_REF), GDS2843, 14311 (Gene ID), M61737

DataSet type:: Expression profiling by array, transformed count, 40 samples

ID:: 42110167

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11374881916.

Cidec - Fasting effect on white adipose tissue, liver and skeletal muscle

Annotation:: Cidec, cell death-inducing DFFA-like effector c

Organism:: Mus musculus

Reporter:: GPL11533, 10546929 (ID_REF), GDS4918, NM_178373, M61737, chr6:113374628-113385749 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 30 samples

ID:: 113748819

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10681373917.

Cidec - Pancreatic cancer-induced cachexia model: muscle, liver and white adipose tissue

Annotation:: Cidec, cell death-inducing DFFA-like effector c

Organism:: Mus musculus

Reporter:: GPL6246, 10546929 (ID_REF), GDS4899, NM_178373, BC099676, M61737, chr6:113424634-113435755 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 18 samples

ID:: 106813739

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1492456718.

Cidec - Growth hormone effect on adipocytes: time course

Annotation:: Cidec, cell death-inducing DFFA-like effector c

Organism:: Mus musculus

Reporter:: GPL81, 102016_at (ID_REF), GDS1489, 14311 (Gene ID), M61737

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 14924567

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2261306719.

Cidec - Fibroblast growth factor receptor 1 activation effect on mammary glands: time course

Annotation:: Cidec, cell death-inducing DFFA-like effector c

Organism:: Mus musculus

Reporter:: GPL81, 102016_at (ID_REF), GDS1955, 14311 (Gene ID), M61737

DataSet type:: Expression profiling by array, count, 19 samples

ID:: 22613067

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 736496720.

Cidec - Peroxisome proliferator-activated receptor-gamma target genes in aorta

Annotation:: Cidec, cell death-inducing DFFA-like effector c

Organism:: Mus musculus

Reporter:: GPL81, 102016_at (ID_REF), GDS859, 14311 (Gene ID), M61737

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 7364967

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 24

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 201107) (468)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 1 to 20 of 468

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity