GEO Profiles Links for Nucleotide (Select 26086188) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 1 to 20 of 28

<< First< Prev

Page of 2

Next >Last >>

Select item 1194244781.

Chronic, low level drug exposure effect on obese liver

Annotation:: Transcribed locus

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P899685 (ID_REF), GDS5258, AK037956, A_52_P899685 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 24 samples

ID:: 119424478

GEO DataSets Profile neighbors

Select item 1270737242.

17β-estradiol effect on uterus of uterine epithelial ERα conditional knockout model: time course

Annotation:: Transcribed locus

Organism:: Mus musculus

Reporter:: GPL4134, 40524 (ID_REF), GDS5461, AK037956, A_52_P899685 (SPOT ID)

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 127073724

GEO DataSets Profile neighbors

Select item 728584783.

Spatial and temporal development of mammalian salivary glands

Annotation:: Transcribed locus

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P899685 (ID_REF), GDS3922, AK037956, A_52_P899685 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 84 samples

ID:: 72858478

GEO DataSets

Select item 1304685784.

4T1 breast cancer model: metastatic sub-populations

Annotation:: Transcribed locus

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P899685 (ID_REF), GDS5666, AK037956, A_52_P899685 (SPOT ID)

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 130468578

GEO DataSets Profile neighbors

Select item 1316617785.

Normal liver developmental stages: embryonic and postnatal

Annotation:: Transcribed locus

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P899685 (ID_REF), GDS5818, AK037956, A_52_P899685 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 11 samples

ID:: 131661778

GEO DataSets Profile neighbors

Select item 1303855246.

Estradiol effect on uterus of EAAE estrogen receptor α DNA-binding-deficient model

Annotation:: Transcribed locus

Organism:: Mus musculus

Reporter:: GPL4134, 40524 (ID_REF), GDS5664, AK037956, A_52_P899685 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 130385524

GEO DataSets Profile neighbors

Select item 529895467.

Liver response to Pacific ciguatoxin-1: time course

Annotation:: Transcribed locus

Organism:: Mus musculus

Reporter:: GPL2872, 43146 (ID_REF), GDS3259, AK037956, A_52_P899685 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 9 samples

ID:: 52989546

GEO DataSets Profile neighbors

Select item 1284433788.

Sirtuin-1 deficiency effect on adult secondary neurospheres

Annotation:: Transcribed locus

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P899685 (ID_REF), GDS5611, AK037956, A_52_P899685 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 4 samples

ID:: 128443378

GEO DataSets Profile neighbors

Select item 1092504249.

Diabetic db/db heart response to rosiglitazone

Annotation:: Transcribed locus

Organism:: Mus musculus

Reporter:: GPL4134, 40524 (ID_REF), GDS4990, AK037956, A_52_P899685 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 15 samples

ID:: 109250424

GEO DataSets Profile neighbors

Select item 12848597810.

Sirtuin-1 activator resveratrol effect on adult secondary neurospheres

Annotation:: Transcribed locus

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P899685 (ID_REF), GDS5612, AK037956, A_52_P899685 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 4 samples

ID:: 128485978

GEO DataSets Profile neighbors

Select item 752954611.

MPSS transcriptome analysis project

Annotation:: Transcribed locus

Organism:: Mus musculus

Reporter:: GPL1010, GATCCATCACAGCCAGCATG (ID_REF), GDS868, AK037956

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7529546

GEO DataSets

Select item 7156027812.

Interstrain differences in the liver effects of trichloroethylene

Annotation:: Transcribed locus

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P899685 (ID_REF), GDS3890, AK037956, A_52_P899685 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 94 samples

ID:: 71560278

GEO DataSets

Select item 12269127813.

T helper type 9 cells stimulated with anti-CD3 antibody

Annotation:: Transcribed locus

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P899685 (ID_REF), GDS5343, AK037956, A_52_P899685 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 122691278

GEO DataSets Profile neighbors

Select item 12916027814.

Citrobacter rodentium infection of interleukin-10 deficient colon

Annotation:: Transcribed locus

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P899685 (ID_REF), GDS5629, AK037956, A_52_P899685 (SPOT ID)

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 129160278

GEO DataSets Profile neighbors

Select item 11969757815.

High-fat diet effect on obesity-resistant NAG-1 transgenics: colon epithelium

Annotation:: Transcribed locus

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P899685 (ID_REF), GDS5264, AK037956, A_52_P899685 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 11 samples

ID:: 119697578

GEO DataSets Profile neighbors

Select item 12093707816.

T helper type 9 cells

Annotation:: Transcribed locus

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P899685 (ID_REF), GDS5291, AK037956, A_52_P899685 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 9 samples

ID:: 120937078

GEO DataSets Profile neighbors

Select item 5521282417.

Iron enriched and deficient diets effect on the liver

Annotation:: Transcribed locus

Organism:: Mus musculus

Reporter:: GPL4134, 40524 (ID_REF), GDS3373, AK037956, A_52_P899685 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 30 samples

ID:: 55212824

GEO DataSets Profile neighbors

Select item 11533822418.

Glucocorticoid effect on the female liver

Annotation:: Transcribed locus

Organism:: Mus musculus

Reporter:: GPL4134, 40524 (ID_REF), GDS5036, AK037956, A_52_P899685 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 115338224

GEO DataSets Profile neighbors

Select item 11827237819.

Hoxa1 deficiency effect on rhombomere regions 3 to 5

Annotation:: Transcribed locus

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P899685 (ID_REF), GDS5228, AK037956, A_52_P899685 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 118272378

GEO DataSets Profile neighbors

Select item 3191754620.

Resveratrol and high-fat high-calorie diet effect on liver

Annotation:: Transcribed locus

Organism:: Mus musculus

Reporter:: GPL2872, 43146 (ID_REF), GDS2413, AK037956, A_52_P899685 (SPOT ID)

DataSet type:: Expression profiling by array, Z-score, 14 samples

ID:: 31917546

GEO DataSets Profile neighbors

<< First< Prev

Page of 2

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 26086188) (28)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 1 to 20 of 28

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity