GEO Profiles Links for Nucleotide (Select 26087721) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 12

Select item 318767931.

Slc38a1 - Resveratrol and high-fat high-calorie diet effect on liver

Annotation:: Slc38a1, solute carrier family 38, member 1

Organism:: Mus musculus

Reporter:: GPL2872, 2393 (ID_REF), GDS2413, AK040250, A_52_P190992 (SPOT ID)

DataSet type:: Expression profiling by array, Z-score, 14 samples

ID:: 31876793

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1303465802.

Slc38a1 - Estradiol effect on uterus of EAAE estrogen receptor α DNA-binding-deficient model

Annotation:: Slc38a1, solute carrier family 38, member 1

Organism:: Mus musculus

Reporter:: GPL4134, 1580 (ID_REF), GDS5664, AK040250, A_52_P190992 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 130346580

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1270347803.

Slc38a1 - 17β-estradiol effect on uterus of uterine epithelial ERα conditional knockout model: time course

Annotation:: Slc38a1, solute carrier family 38, member 1

Organism:: Mus musculus

Reporter:: GPL4134, 1580 (ID_REF), GDS5461, AK040250, A_52_P190992 (SPOT ID)

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 127034780

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 529487934.

Slc38a1 - Liver response to Pacific ciguatoxin-1: time course

Annotation:: Slc38a1, solute carrier family 38, member 1

Organism:: Mus musculus

Reporter:: GPL2872, 2393 (ID_REF), GDS3259, AK040250, A_52_P190992 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 9 samples

ID:: 52948793

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 551738805.

Slc38a1 - Iron enriched and deficient diets effect on the liver

Annotation:: Slc38a1, solute carrier family 38, member 1

Organism:: Mus musculus

Reporter:: GPL4134, 1580 (ID_REF), GDS3373, AK040250, A_52_P190992 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 30 samples

ID:: 55173880

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1222788806.

Slc38a1 - Industrial pollution effect on liver

Annotation:: Slc38a1, solute carrier family 38, member 1

Organism:: Mus musculus, Mus spretus

Reporter:: GPL4134, 1580 (ID_REF), GDS5331, AK040250, A_52_P190992 (SPOT ID)

DataSet type:: Expression profiling by array, count, 19 samples

ID:: 122278880

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 74983997.

Slc38a1 - MPSS transcriptome analysis project

Annotation:: Slc38a1, solute carrier family 38, member 1

Organism:: Mus musculus

Reporter:: GPL1010, GATCACTGCCAAGGACAGGC (ID_REF), GDS868, AK040250

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7498399

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 1152992808.

Slc38a1 - Glucocorticoid effect on the female liver

Annotation:: Slc38a1, solute carrier family 38, member 1

Organism:: Mus musculus

Reporter:: GPL4134, 1580 (ID_REF), GDS5036, AK040250, A_52_P190992 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 115299280

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1152526809.

Slc38a1 - Glucocorticoid effect on the male liver

Annotation:: Slc38a1, solute carrier family 38, member 1

Organism:: Mus musculus

Reporter:: GPL4134, 1580 (ID_REF), GDS5035, AK040250, A_52_P190992 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 115252680

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10921148010.

Slc38a1 - Diabetic db/db heart response to rosiglitazone

Annotation:: Slc38a1, solute carrier family 38, member 1

Organism:: Mus musculus

Reporter:: GPL4134, 1580 (ID_REF), GDS4990, AK040250, A_52_P190992 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 15 samples

ID:: 109211480

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 5179049311.

Slc38a1 - Interleukin-22 effect on colon cultures

Annotation:: Slc38a1, solute carrier family 38, member 1

Organism:: Mus musculus

Reporter:: GPL2872, 2393 (ID_REF), GDS3226, AK040250, A_52_P190992 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 6 samples

ID:: 51790493

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 763609912.

Slc38a1 - MPSS analysis of BLK CL.4 and liver cells

Annotation:: Slc38a1, solute carrier family 38, member 1

Organism:: Mus musculus

Reporter:: GPL1010, GATCACTGCCAAGGACAGGC (ID_REF), GDS878, AK040250

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7636099

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 26087721) (12)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 12

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity