GEO Profiles Links for Nucleotide (Select 26089047) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 17

Select item 978625071.

Fem1a - Atherosclerosis susceptibility model: macrophages

Annotation:: Fem1a, feminization 1 homolog a (C. elegans)

Organism:: Mus musculus

Reporter:: GPL9734, 100107579_TGI_at (ID_REF), GDS4527, AK042461

DataSet type:: Expression profiling by array, count, 20 samples

ID:: 97862507

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 971495072.

Fem1a - SmoA1 and SmoA2 models of medulloblastoma: postnatal day 5 brain

Annotation:: Fem1a, feminization 1 homolog a (C. elegans)

Organism:: Mus musculus

Reporter:: GPL9734, 100107579_TGI_at (ID_REF), GDS4495, AK042461

DataSet type:: Expression profiling by array, count, 9 samples

ID:: 97149507

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 644691073.

Fem1a - Hypertension model: kidney

Annotation:: Fem1a, feminization 1 homolog a (C. elegans)

Organism:: Mus musculus

Reporter:: GPL9734, 100107579_TGI_at (ID_REF), GDS3675, AK042461

DataSet type:: Expression profiling by array, count, 14 samples

ID:: 64469107

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 644295074.

Fem1a - Hypertension model: liver

Annotation:: Fem1a, feminization 1 homolog a (C. elegans)

Organism:: Mus musculus

Reporter:: GPL9734, 100107579_TGI_at (ID_REF), GDS3674, AK042461

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 64429507

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 643899075.

Fem1a - Hypertension model: heart

Annotation:: Fem1a, feminization 1 homolog a (C. elegans)

Organism:: Mus musculus

Reporter:: GPL9734, 100107579_TGI_at (ID_REF), GDS3673, AK042461

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 64389907

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 643503076.

Fem1a - Hypertension model: aorta

Annotation:: Fem1a, feminization 1 homolog a (C. elegans)

Organism:: Mus musculus

Reporter:: GPL9734, 100107579_TGI_at (ID_REF), GDS3672, AK042461

DataSet type:: Expression profiling by array, count, 23 samples

ID:: 64350307

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 76507907.

Fem1a - MPSS analysis of BLK CL.4 and liver cells

Annotation:: Fem1a, feminization 1 homolog a (C. elegans)

Organism:: Mus musculus

Reporter:: GPL1010, GATCAGAAATCCAAGTTAAA (ID_REF), GDS878, AK042461

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7650790

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 75130908.

Fem1a - MPSS transcriptome analysis project

Annotation:: Fem1a, feminization 1 homolog a (C. elegans)

Organism:: Mus musculus

Reporter:: GPL1010, GATCAGAAATCCAAGTTAAA (ID_REF), GDS868, AK042461

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7513090

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 61412209.

Guca1b - Blastocyst dormancy and activation comparison

Annotation:: Guca1b, guanylate cyclase activator 1B (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL870, 4920 (ID_REF), GDS752, AK005041, AK009354, AK034412, AK042461, AK075860, AK080978, BC009161, BC033364, G0115A06-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 6 samples

ID:: 6141220

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 613824010.

Guca1b - Blastocyst dormancy and activation comparison

Annotation:: Guca1b, guanylate cyclase activator 1B (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL870, 1940 (ID_REF), GDS752, AK005041, AK009354, AK034412, AK042461, AK075860, AK080978, BC009161, BC033364, C0272C03-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 6 samples

ID:: 6138240

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 613758911.

Guca1b - Blastocyst dormancy and activation comparison

Annotation:: Guca1b, guanylate cyclase activator 1B (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL870, 1289 (ID_REF), GDS752, AK005041, AK009354, AK034412, AK042461, AK075860, AK080978, BC009161, BC033364, C0192H02-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 6 samples

ID:: 6137589

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 447402012.

Guca1b - Zygotic gene activation

Annotation:: Guca1b, guanylate cyclase activator 1B (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL870, 4920 (ID_REF), GDS579, AK005041, AK009354, AK034412, AK042461, AK075860, AK080978, BC009161, BC033364, G0115A06-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 36 samples

ID:: 4474020

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 447104013.

Guca1b - Zygotic gene activation

Annotation:: Guca1b, guanylate cyclase activator 1B (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL870, 1940 (ID_REF), GDS579, AK005041, AK009354, AK034412, AK042461, AK075860, AK080978, BC009161, BC033364, C0272C03-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 36 samples

ID:: 4471040

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 447038914.

Guca1b - Zygotic gene activation

Annotation:: Guca1b, guanylate cyclase activator 1B (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL870, 1289 (ID_REF), GDS579, AK005041, AK009354, AK034412, AK042461, AK075860, AK080978, BC009161, BC033364, C0192H02-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 36 samples

ID:: 4470389

GEO DataSets Gene Chromosome neighbors

Select item 445072015.

Guca1b - Preimplantation development

Annotation:: Guca1b, guanylate cyclase activator 1B (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL870, 4920 (ID_REF), GDS578, AK005041, AK009354, AK034412, AK042461, AK075860, AK080978, BC009161, BC033364, G0115A06-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 28 samples

ID:: 4450720

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 444774016.

Guca1b - Preimplantation development

Annotation:: Guca1b, guanylate cyclase activator 1B (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL870, 1940 (ID_REF), GDS578, AK005041, AK009354, AK034412, AK042461, AK075860, AK080978, BC009161, BC033364, C0272C03-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 28 samples

ID:: 4447740

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 444708917.

Guca1b - Preimplantation development

Annotation:: Guca1b, guanylate cyclase activator 1B (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL870, 1289 (ID_REF), GDS578, AK005041, AK009354, AK034412, AK042461, AK075860, AK080978, BC009161, BC033364, C0192H02-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 28 samples

ID:: 4447089

GEO DataSets Gene Chromosome neighbors

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 26089047) (17)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 17

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity