GEO Profiles Links for Nucleotide (Select 26101529) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 19

Select item 1278518481.

Golim4 - Rhabdomyosarcoma model

Annotation:: Golim4, golgi integral membrane protein 4

Organism:: Mus musculus

Reporter:: GPL6481, 104280368 (ID_REF), GDS5527, AK083843

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 127851848

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 824831072.

Golim4 - ROR alpha1 deletion effect on skeletal muscle

Annotation:: Golim4, golgi integral membrane protein 4

Organism:: Mus musculus

Reporter:: GPL6105, ILMN_2429997 (ID_REF), GDS3720, AK083843

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 82483107

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 756791483.

Golim4 - High, Normal, and Low Anxiety: multiple brain regions

Annotation:: Golim4, golgi integral membrane protein 4

Organism:: Mus musculus

Reporter:: GPL6481, 104280368 (ID_REF), GDS4002, AK083843

DataSet type:: Expression profiling by array, count, 75 samples

ID:: 75679148

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 662218074.

Golim4 - X chromosome dosage model

Annotation:: Golim4, golgi integral membrane protein 4

Organism:: Mus musculus

Reporter:: GPL6105, ILMN_2429997 (ID_REF), GDS3728, AK083843

DataSet type:: Expression profiling by array, transformed count, 36 samples

ID:: 66221807

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 653215075.

Golim4 - Addictive drugs effect on brain striatum: time course

Annotation:: Golim4, golgi integral membrane protein 4

Organism:: Mus musculus

Reporter:: GPL6105, ILMN_2429997 (ID_REF), GDS3703, AK083843

DataSet type:: Expression profiling by array, transformed count, 108 samples

ID:: 65321507

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 625965456.

Golim4 - Huntington disease model: brain striatum (Ref-6 V1)

Annotation:: Golim4, golgi integral membrane protein 4

Organism:: Mus musculus

Reporter:: GPL6333, scl0002083.1_6-S (ID_REF), GDS3621, AK083843

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 62596545

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 619961457.

Golim4 - Eset depletion effect on embryonic stem cell

Annotation:: Golim4, golgi integral membrane protein 4

Organism:: Mus musculus

Reporter:: GPL6333, scl0002083.1_6-S (ID_REF), GDS3599, AK083843

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 61996145

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 596577078.

Golim4 - Lung response to aerosolized non-typeable Haemophilus influenza lysate: time course

Annotation:: Golim4, golgi integral membrane protein 4

Organism:: Mus musculus

Reporter:: GPL6105, ILMN_2429997 (ID_REF), GDS3522, AK083843

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 59657707

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 546461149.

Golim4 - Skin carcinogenesis model

Annotation:: Golim4, golgi integral membrane protein 4

Organism:: Mus musculus

Reporter:: GPL4234, 104280368 (ID_REF), GDS3334, AK083843

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 54646114

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4903290410.

Golim4 - Chronic hypoxia effect on the developing brain

Annotation:: Golim4, golgi integral membrane protein 4

Organism:: Mus musculus

Reporter:: GPL5402, scl0002083.1_6 (ID_REF), GDS3114, AK083843

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 49032904

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 4821631411.

Golim4 - Iron overload effect on cardiac and skeletal muscles

Annotation:: Golim4, golgi integral membrane protein 4

Organism:: Mus musculus

Reporter:: GPL4234, 104280368 (ID_REF), GDS3086, AK083843

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 48216314

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4694561412.

Golim4 - Histone H3 lysine 9 demethylase depletion effect on embryonic stem cells

Annotation:: Golim4, golgi integral membrane protein 4

Organism:: Mus musculus

Reporter:: GPL4234, 104280368 (ID_REF), GDS3037, AK083843

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 46945614

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 4681654813.

Golim4 - Dicer inactivation effect on the embryonic heart

Annotation:: Golim4, golgi integral membrane protein 4

Organism:: Mus musculus

Reporter:: GPL5025, 19048 (ID_REF), GDS3033, AK083843

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 46816548

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4600441414.

Golim4 - Histone deacetylase 5 deficient nucleus accumbens response to cocaine

Annotation:: Golim4, golgi integral membrane protein 4

Organism:: Mus musculus

Reporter:: GPL4234, 104280368 (ID_REF), GDS2993, AK083843

DataSet type:: Expression profiling by array, transformed count, 30 samples

ID:: 46004414

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 4141715815.

Golim4 - Nephronophthisis model

Annotation:: Golim4, golgi integral membrane protein 4

Organism:: Mus musculus

Reporter:: GPL2897, 216078 (ID_REF), GDS2817, AK083843

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 41417158

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 3219512116.

Golim4 - Fibroblast growth factor 2 effect on embryonic fibroblast: dose response

Annotation:: Golim4, golgi integral membrane protein 4

Organism:: Mus musculus

Reporter:: GPL4055, scl0002083.1_6-S (ID_REF), GDS2421, AK083843

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 32195121

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 1878955817.

Golim4 - MicroRNA miR-122 antisense inhibition effect on livers

Annotation:: Golim4, golgi integral membrane protein 4

Organism:: Mus musculus

Reporter:: GPL2897, 216078 (ID_REF), GDS1729, AK083843

DataSet type:: Expression profiling by array, count, 10 samples

ID:: 18789558

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 767095018.

Golim4 - MPSS analysis of BLK CL.4 and liver cells

Annotation:: Golim4, golgi integral membrane protein 4

Organism:: Mus musculus

Reporter:: GPL1010, GATCCCCAGGAATACACCTC (ID_REF), GDS878, AK083843

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7670950

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 753325019.

Golim4 - MPSS transcriptome analysis project

Annotation:: Golim4, golgi integral membrane protein 4

Organism:: Mus musculus

Reporter:: GPL1010, GATCCCCAGGAATACACCTC (ID_REF), GDS868, AK083843

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7533250

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 26101529) (19)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 19

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity