GEO Profiles Links for Nucleotide (Select 27924300) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 1 to 20 of 148

<< First< Prev

Page of 8

Next >Last >>

Select item 74761421.

Pitpnm1 - MPSS transcriptome analysis project

Annotation:: Pitpnm1, phosphatidylinositol transfer protein, membrane-associated 1

Organism:: Mus musculus

Reporter:: GPL1010, GATCCAGAGGCCCTAGCCAG (ID_REF), GDS868, BC044893

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7476142

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1143955992.

Pitpnm1 - Transforming growth factor beta effect on cytokine-activated, NOD-derived, splenic natural killer cells

Annotation:: Pitpnm1, phosphatidylinositol transfer protein, membrane-associated 1

Organism:: Mus musculus

Reporter:: GPL6246, 10460317 (ID_REF), GDS4948, NM_008851, NR_075078, XM_006531680, XR_388252, AF006467, BC044893, BC048150, chr19:4100117-4113965 (SPOT ID)

DataSet type:: Expression profiling by array, count, 9 samples

ID:: 114395599

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1290955993.

Pitpnm1 - Circadian nuclear receptor REV-ERBα deficiency effect on ventral midbrain

Annotation:: Pitpnm1, phosphatidylinositol transfer protein, membrane-associated 1

Organism:: Mus musculus

Reporter:: GPL6246, 10460317 (ID_REF), GDS5628, NM_008851, NR_075078, XM_006531680, XR_388252, AF006467, BC044893, BC048150, chr19:4100117-4113965 (SPOT ID)

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 129095599

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1143588994.

Pitpnm1 - Regulatory T cell ablation effect on BDC2.5/NOD pancreatic or splenic natural killer cells: time course

Annotation:: Pitpnm1, phosphatidylinositol transfer protein, membrane-associated 1

Organism:: Mus musculus

Reporter:: GPL6246, 10460317 (ID_REF), GDS4946, NM_008851, NR_075078, XM_006531680, XR_388252, AF006467, BC044893, BC048150, chr19:4100117-4113965 (SPOT ID)

DataSet type:: Expression profiling by array, count, 32 samples

ID:: 114358899

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 968314995.

Pitpnm1 - Heterozygous null CREB binding protein mutant response to environmental enrichment: hippocampus

Annotation:: Pitpnm1, phosphatidylinositol transfer protein, membrane-associated 1

Organism:: Mus musculus

Reporter:: GPL6246, 10460317 (ID_REF), GDS4486, NM_008851, NR_075078, XM_006531680, XR_388252, AF006467, BC044893, BC048150, chr19:4100117-4113965 (SPOT ID)

DataSet type:: Expression profiling by array, count, 16 samples

ID:: 96831499

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1000552996.

Pitpnm1 - APCΔ468 model of polyposis: regulatory T cells from various organs

Annotation:: Pitpnm1, phosphatidylinositol transfer protein, membrane-associated 1

Organism:: Mus musculus

Reporter:: GPL6246, 10460317 (ID_REF), GDS4588, NM_008851, NR_075078, XM_006531680, XR_388252, AF006467, BC044893, BC048150, chr19:4100117-4113965 (SPOT ID)

DataSet type:: Expression profiling by array, count, 44 samples

ID:: 100055299

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 996654997.

Pitpnm1 - Lipopolysaccharide-stimulated, NFκB ζ inhibitor (IκBζ) deficient-peritoneal macrophages

Annotation:: Pitpnm1, phosphatidylinositol transfer protein, membrane-associated 1

Organism:: Mus musculus

Reporter:: GPL6246, 10460317 (ID_REF), GDS4578, NM_008851, NR_075078, XM_006531680, XR_388252, AF006467, BC044893, BC048150, chr19:4100117-4113965 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 99665499

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 751005998.

Pitpnm1 - Segmented filamentous bacteria gut colonization effect on nonobese diabetic mice: T cells

Annotation:: Pitpnm1, phosphatidylinositol transfer protein, membrane-associated 1

Organism:: Mus musculus

Reporter:: GPL6246, 10460317 (ID_REF), GDS3987, NM_008851, NR_075078, XM_006531680, XR_388252, AF006467, BC044893, BC048150, chr19:4100117-4113965 (SPOT ID)

DataSet type:: Expression profiling by array, count, 26 samples

ID:: 75100599

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 76138429.

Pitpnm1 - MPSS analysis of BLK CL.4 and liver cells

Annotation:: Pitpnm1, phosphatidylinositol transfer protein, membrane-associated 1

Organism:: Mus musculus

Reporter:: GPL1010, GATCCAGAGGCCCTAGCCAG (ID_REF), GDS878, BC044893

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7613842

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 13050659910.

Pitpnm1 - Macrophage-restricted interleukin-10 receptor deficiency effect on colonic resident macrophages

Annotation:: Pitpnm1, phosphatidylinositol transfer protein, membrane-associated 1

Organism:: Mus musculus

Reporter:: GPL6246, 10460317 (ID_REF), GDS5668, NM_008851, NR_075078, XM_006531680, XR_388252, AF006467, BC044893, BC048150, chr19:4100117-4113965 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 5 samples

ID:: 130506599

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11085149911.

Pitpnm1 - Pristane-induced arthritis effect on AIRmax and AIRmin acute inflammation model: footpad

Annotation:: Pitpnm1, phosphatidylinositol transfer protein, membrane-associated 1

Organism:: Mus musculus

Reporter:: GPL6246, 10460317 (ID_REF), GDS5052, NM_008851, NR_075078, XM_006531680, XR_388252, AF006467, BC044893, BC048150, chr19:4100117-4113965 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 110851499

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11552579912.

Pitpnm1 - Transciption factor Meis1 deficiency effect on lineage-negative bone marrow cells

Annotation:: Pitpnm1, phosphatidylinositol transfer protein, membrane-associated 1

Organism:: Mus musculus

Reporter:: GPL6246, 10460317 (ID_REF), GDS5095, NM_008851, NR_075078, XM_006531680, XR_388252, AF006467, BC044893, BC048150, chr19:4100117-4113965 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 4 samples

ID:: 115525799

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12568129913.

Pitpnm1 - Transcription factor E2-2 haplodeficiency effect on systemic lupus erythematosus model: splenocytes

Annotation:: Pitpnm1, phosphatidylinositol transfer protein, membrane-associated 1

Organism:: Mus musculus

Reporter:: GPL6246, 10460317 (ID_REF), GDS5421, NM_008851, NR_075078, XM_006531680, XR_388252, AF006467, BC044893, BC048150, chr19:4100117-4113965 (SPOT ID)

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 125681299

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8697099914.

Pitpnm1 - Gfi1b overexpression in a pro-B Abelson leukemia virus transformed cell line

Annotation:: Pitpnm1, phosphatidylinositol transfer protein, membrane-associated 1

Organism:: Mus musculus

Reporter:: GPL6246, 10460317 (ID_REF), GDS4302, NM_008851, NR_075078, XM_006531680, XR_388252, AF006467, BC044893, BC048150, chr19:4100117-4113965 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 86970999

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 9742989915.

Pitpnm1 - Model for the manic pole of bipolar disorder: hippocampus

Annotation:: Pitpnm1, phosphatidylinositol transfer protein, membrane-associated 1

Organism:: Mus musculus

Reporter:: GPL6246, 10460317 (ID_REF), GDS4517, NM_008851, NR_075078, XM_006531680, XR_388252, AF006467, BC044893, BC048150, chr19:4100117-4113965 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 97429899

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10847289916.

Pitpnm1 - Pyrazinamide effect on pulmonary tuberculosis model : time course

Annotation:: Pitpnm1, phosphatidylinositol transfer protein, membrane-associated 1

Organism:: Mus musculus

Reporter:: GPL6246, 10460317 (ID_REF), GDS4967, NM_008851, NR_075078, XM_006531680, XR_388252, AF006467, BC044893, BC048150, chr19:4100117-4113965 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 16 samples

ID:: 108472899

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11077809917.

Pitpnm1 - Pristane-induced arthritis effect on AIRmax high acute inflammation model: footpad

Annotation:: Pitpnm1, phosphatidylinositol transfer protein, membrane-associated 1

Organism:: Mus musculus

Reporter:: GPL6246, 10460317 (ID_REF), GDS5050, NM_008851, NR_075078, XM_006531680, XR_388252, AF006467, BC044893, BC048150, chr19:4100117-4113965 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 110778099

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7555139918.

Pitpnm1 - Regulatory, pathogenic and control CD4+ T cells

Annotation:: Pitpnm1, phosphatidylinositol transfer protein, membrane-associated 1

Organism:: Mus musculus

Reporter:: GPL6246, 10460317 (ID_REF), GDS3999, NM_008851, NR_075078, XM_006531680, XR_388252, AF006467, BC044893, BC048150, chr19:4100117-4113965 (SPOT ID)

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 75551399

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10175439919.

Pitpnm1 - Hematopoietic cell response to Xist deficiency in females: time course

Annotation:: Pitpnm1, phosphatidylinositol transfer protein, membrane-associated 1

Organism:: Mus musculus

Reporter:: GPL6246, 10460317 (ID_REF), GDS4755, NM_008851, NR_075078, XM_006531680, XR_388252, AF006467, BC044893, BC048150, chr19:4100117-4113965 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 20 samples

ID:: 101754399

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11486559920.

Pitpnm1 - Kidney epithelium cell line response to Influenza A virus (H3N2) non-structural 1 gene mutations

Annotation:: Pitpnm1, phosphatidylinositol transfer protein, membrane-associated 1

Organism:: Mus musculus

Reporter:: GPL6246, 10460317 (ID_REF), GDS4998, NM_008851, NR_075078, XM_006531680, XR_388252, AF006467, BC044893, BC048150, chr19:4100117-4113965 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 18 samples

ID:: 114865599

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 8

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 27924300) (148)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 1 to 20 of 148

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity