GEO Profiles Links for Nucleotide (Select 42490936) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 17

Select item 76714261.

Rb1cc1 - MPSS analysis of BLK CL.4 and liver cells

Annotation:: Rb1cc1, RB1-inducible coiled-coil 1

Organism:: Mus musculus

Reporter:: GPL1010, GATCTGTGCCATTTCAGAAC (ID_REF), GDS878, BC066152

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7671426

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 75337262.

Rb1cc1 - MPSS transcriptome analysis project

Annotation:: Rb1cc1, RB1-inducible coiled-coil 1

Organism:: Mus musculus

Reporter:: GPL1010, GATCTGTGCCATTTCAGAAC (ID_REF), GDS868, BC066152

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7533726

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 61536173.

Rb1cc1 - Blastocyst dormancy and activation comparison

Annotation:: Rb1cc1, RB1-inducible coiled-coil 1

Organism:: Mus musculus

Reporter:: GPL870, 17317 (ID_REF), GDS752, AB050017, AB070619, AB093216, AJ242720, AK013696, AK020027, AK033709, AK041038, BC012669, BC066152, K0605G06-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 6 samples

ID:: 6153617

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 61525414.

Rb1cc1 - Blastocyst dormancy and activation comparison

Annotation:: Rb1cc1, RB1-inducible coiled-coil 1

Organism:: Mus musculus

Reporter:: GPL870, 16241 (ID_REF), GDS752, AB050017, AB070619, AB093216, AJ242720, AK013696, AK020027, AK033709, AK041038, BC012669, BC066152, K0346D06-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 6 samples

ID:: 6152541

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 61456035.

Rb1cc1 - Blastocyst dormancy and activation comparison

Annotation:: Rb1cc1, RB1-inducible coiled-coil 1

Organism:: Mus musculus

Reporter:: GPL870, 9303 (ID_REF), GDS752, AB050017, AB070619, AB093216, AJ242720, AK013696, AK020027, AK033709, AK041038, BC012669, BC066152, H3079D07-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 6 samples

ID:: 6145603

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 61401236.

Rb1cc1 - Blastocyst dormancy and activation comparison

Annotation:: Rb1cc1, RB1-inducible coiled-coil 1

Organism:: Mus musculus

Reporter:: GPL870, 3823 (ID_REF), GDS752, AB050017, AB070619, AB093216, AJ242720, AK013696, AK020027, AK033709, AK041038, BC012669, BC066152, C0902B02-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 6 samples

ID:: 6140123

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 61373147.

Rrs1 - Blastocyst dormancy and activation comparison

Annotation:: Rrs1, ribosome biogenesis regulator 1 (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL870, 1014 (ID_REF), GDS752, AK010178, AK013172, AK017683, AK019257, AK019913, AK122207, BC003481, BC066152, C0173B12-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 6 samples

ID:: 6137314

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 44864178.

Rb1cc1 - Zygotic gene activation

Annotation:: Rb1cc1, RB1-inducible coiled-coil 1

Organism:: Mus musculus

Reporter:: GPL870, 17317 (ID_REF), GDS579, AB050017, AB070619, AB093216, AJ242720, AK013696, AK020027, AK033709, AK041038, BC012669, BC066152, K0605G06-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 36 samples

ID:: 4486417

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 44853419.

Rb1cc1 - Zygotic gene activation

Annotation:: Rb1cc1, RB1-inducible coiled-coil 1

Organism:: Mus musculus

Reporter:: GPL870, 16241 (ID_REF), GDS579, AB050017, AB070619, AB093216, AJ242720, AK013696, AK020027, AK033709, AK041038, BC012669, BC066152, K0346D06-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 36 samples

ID:: 4485341

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 447840310.

Rb1cc1 - Zygotic gene activation

Annotation:: Rb1cc1, RB1-inducible coiled-coil 1

Organism:: Mus musculus

Reporter:: GPL870, 9303 (ID_REF), GDS579, AB050017, AB070619, AB093216, AJ242720, AK013696, AK020027, AK033709, AK041038, BC012669, BC066152, H3079D07-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 36 samples

ID:: 4478403

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 447292311.

Rb1cc1 - Zygotic gene activation

Annotation:: Rb1cc1, RB1-inducible coiled-coil 1

Organism:: Mus musculus

Reporter:: GPL870, 3823 (ID_REF), GDS579, AB050017, AB070619, AB093216, AJ242720, AK013696, AK020027, AK033709, AK041038, BC012669, BC066152, C0902B02-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 36 samples

ID:: 4472923

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 447011412.

Rrs1 - Zygotic gene activation

Annotation:: Rrs1, ribosome biogenesis regulator 1 (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL870, 1014 (ID_REF), GDS579, AK010178, AK013172, AK017683, AK019257, AK019913, AK122207, BC003481, BC066152, C0173B12-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 36 samples

ID:: 4470114

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 446311713.

Rb1cc1 - Preimplantation development

Annotation:: Rb1cc1, RB1-inducible coiled-coil 1

Organism:: Mus musculus

Reporter:: GPL870, 17317 (ID_REF), GDS578, AB050017, AB070619, AB093216, AJ242720, AK013696, AK020027, AK033709, AK041038, BC012669, BC066152, K0605G06-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 28 samples

ID:: 4463117

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 446204114.

Rb1cc1 - Preimplantation development

Annotation:: Rb1cc1, RB1-inducible coiled-coil 1

Organism:: Mus musculus

Reporter:: GPL870, 16241 (ID_REF), GDS578, AB050017, AB070619, AB093216, AJ242720, AK013696, AK020027, AK033709, AK041038, BC012669, BC066152, K0346D06-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 28 samples

ID:: 4462041

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 445510315.

Rb1cc1 - Preimplantation development

Annotation:: Rb1cc1, RB1-inducible coiled-coil 1

Organism:: Mus musculus

Reporter:: GPL870, 9303 (ID_REF), GDS578, AB050017, AB070619, AB093216, AJ242720, AK013696, AK020027, AK033709, AK041038, BC012669, BC066152, H3079D07-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 28 samples

ID:: 4455103

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 444962316.

Rb1cc1 - Preimplantation development

Annotation:: Rb1cc1, RB1-inducible coiled-coil 1

Organism:: Mus musculus

Reporter:: GPL870, 3823 (ID_REF), GDS578, AB050017, AB070619, AB093216, AJ242720, AK013696, AK020027, AK033709, AK041038, BC012669, BC066152, C0902B02-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 28 samples

ID:: 4449623

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 444681417.

Rrs1 - Preimplantation development

Annotation:: Rrs1, ribosome biogenesis regulator 1 (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL870, 1014 (ID_REF), GDS578, AK010178, AK013172, AK017683, AK019257, AK019913, AK122207, BC003481, BC066152, C0173B12-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 28 samples

ID:: 4446814

GEO DataSets Gene Profile neighbors Chromosome neighbors

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 42490936) (17)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 17

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity