GEO Profiles Links for Nucleotide (Select 444299607) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 1 to 20 of 306

<< First< Prev

Page of 16

Next >Last >>

Select item 1226365901.

Mat1a - Maternal western diet effect on post-weaning low-fat diet fed offspring liver

Annotation:: Mat1a, methionine adenosyltransferase I, alpha

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2678460 (ID_REF), GDS5342, NM_133653, MAT1A (ORF)

DataSet type:: Expression profiling by array, count, 11 samples

ID:: 122636590

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1210140902.

Mat1a - Maternal western diet effect on post-weaning western diet fed offspring liver

Annotation:: Mat1a, methionine adenosyltransferase I, alpha

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2678460 (ID_REF), GDS5293, NM_133653, MAT1A (ORF)

DataSet type:: Expression profiling by array, count, 11 samples

ID:: 121014090

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1273861553.

Mat1a - TGFβ-activated kinase 1 deficiency effect on liver

Annotation:: Mat1a, methionine adenosyltransferase I, alpha

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_2678460 (ID_REF), GDS5474, NM_133653

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 127386155

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 662191064.

Mat1a - X chromosome dosage model

Annotation:: Mat1a, methionine adenosyltransferase I, alpha

Organism:: Mus musculus

Reporter:: GPL6105, ILMN_2678460 (ID_REF), GDS3728, NM_133653

DataSet type:: Expression profiling by array, transformed count, 36 samples

ID:: 66219106

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1137349055.

Mat1a - Fasting effect on white adipose tissue, liver and skeletal muscle

Annotation:: Mat1a, methionine adenosyltransferase I, alpha

Organism:: Mus musculus

Reporter:: GPL11533, 10414192 (ID_REF), GDS4918, NM_133653, L13622, chr14:41918670-41937706 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 30 samples

ID:: 113734905

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 812111596.

Mat1a - Conditional GBA1 deletion model of Type 1 Gaucher Disease: liver and spleen

Annotation:: Mat1a, methionine adenosyltransferase I, alpha

Organism:: Mus musculus

Reporter:: GPL6246, 10414192 (ID_REF), GDS4162, NM_133653, BC011211, chr14:41105381-41124417 (SPOT ID)

DataSet type:: Expression profiling by array, count, 7 samples

ID:: 81211159

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1116429557.

Mat1a - IL-4 IL-13 double mutant liver response to acute injury

Annotation:: Mat1a, methionine adenosyltransferase I, alpha

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_2678460 (ID_REF), GDS5073, NM_133653

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 111642955

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 650546728.

Mat1a - Lean B6.C-D7Mit353 strain: various tissues

Annotation:: Mat1a, methionine adenosyltransferase I, alpha

Organism:: Mus musculus

Reporter:: GPL2995, 742595 (ID_REF), GDS3692, NM_133653

DataSet type:: Expression profiling by array, count, 25 samples

ID:: 65054672

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 666427599.

Mat1a - Peroxisome proliferator-activated receptor alpha deficiency effect on phthalate-exposed liver

Annotation:: Mat1a, methionine adenosyltransferase I, alpha

Organism:: Mus musculus

Reporter:: GPL6246, 10414192 (ID_REF), GDS3748, NM_133653, BC011211, chr14:41105381-41124417 (SPOT ID)

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 66642759

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6442574010.

Mat1a - Hypertension model: liver

Annotation:: Mat1a, methionine adenosyltransferase I, alpha

Organism:: Mus musculus

Reporter:: GPL9734, 100116525_TGI_at (ID_REF), GDS3674, NM_133653

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 64425740

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11530372111.

Mat1a - Glucocorticoid effect on the female liver

Annotation:: Mat1a, methionine adenosyltransferase I, alpha

Organism:: Mus musculus

Reporter:: GPL4134, 6021 (ID_REF), GDS5036, NM_133653, A_51_P464182 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 115303721

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12621975512.

Mat1a - Dietary palatinose effect on liver

Annotation:: Mat1a, methionine adenosyltransferase I, alpha

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_2678460 (ID_REF), GDS5435, NM_133653

DataSet type:: Expression profiling by array, count, 14 samples

ID:: 126219755

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12580389013.

Mat1a - Monoacylglycerol acyltransferase 1 deficiency effect on high-fat diet fed mice: liver

Annotation:: Mat1a, methionine adenosyltransferase I, alpha

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2678460 (ID_REF), GDS5425, NM_133653, MAT1A (ORF)

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 125803890

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10679955914.

Mat1a - Pancreatic cancer-induced cachexia model: muscle, liver and white adipose tissue

Annotation:: Mat1a, methionine adenosyltransferase I, alpha

Organism:: Mus musculus

Reporter:: GPL6246, 10414192 (ID_REF), GDS4899, NM_133653, BC011211, chr14:41105381-41124417 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 18 samples

ID:: 106799559

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 5517832115.

Mat1a - Iron enriched and deficient diets effect on the liver

Annotation:: Mat1a, methionine adenosyltransferase I, alpha

Organism:: Mus musculus

Reporter:: GPL4134, 6021 (ID_REF), GDS3373, NM_133653, A_51_P464182 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 30 samples

ID:: 55178321

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1879041716.

Mat1a - MicroRNA miR-122 antisense inhibition effect on livers

Annotation:: Mat1a, methionine adenosyltransferase I, alpha

Organism:: Mus musculus

Reporter:: GPL2897, 224041 (ID_REF), GDS1729, NM_133653

DataSet type:: Expression profiling by array, count, 10 samples

ID:: 18790417

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6404726617.

Mat1a - SIRT1 deficiency effect on the liver

Annotation:: Mat1a, methionine adenosyltransferase I, alpha

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P464182 (ID_REF), GDS3666, NM_133653, A_51_P464182 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 64047266

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6356225518.

Mat1a - ob/ob liver response to low doses of leptin

Annotation:: Mat1a, methionine adenosyltransferase I, alpha

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_2678460 (ID_REF), GDS3653, NM_133653

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 63562255

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 767081119.

Mat1a - MPSS analysis of BLK CL.4 and liver cells

Annotation:: Mat1a, methionine adenosyltransferase I, alpha

Organism:: Mus musculus

Reporter:: GPL1010, GATCCTGATGCTGTGTGTGA (ID_REF), GDS878, NM_133653

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7670811

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 9509845520.

Mat1a - Sebacic acid supplemented diet effect on db/db liver

Annotation:: Mat1a, methionine adenosyltransferase I, alpha

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_2678460 (ID_REF), GDS3807, NM_133653

DataSet type:: Expression profiling by array, count, 30 samples

ID:: 95098455

GEO DataSets Gene Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 16

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 444299607) (306)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 1 to 20 of 306

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity