GEO Profiles Links for Nucleotide (Select 56789043) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 1 to 20 of 155

<< First< Prev

Page of 8

Select item 1128783761.

9030619P08Rik - Renal tubular von Hippel-Lindau protein preconditional knockout effect on rhabdomyolysis-induced AKI kidney

Annotation:: 9030619P08Rik, lymphocyte antigen 6 complex pseudogene

Organism:: Mus musculus

Reporter:: GPL6246, 10429588 (ID_REF), GDS4864, NR_108041, BC087965, BC147461, BC147464, chr15:75427606-75431829 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 16 samples

ID:: 112878376

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 1052421762.

9030619P08Rik - Methylmalonic acidemia-associated renal disease model: kidney

Annotation:: 9030619P08Rik, lymphocyte antigen 6 complex pseudogene

Organism:: Mus musculus

Reporter:: GPL6246, 10429588 (ID_REF), GDS4839, NR_108041, BC087965, BC147461, BC147464, chr15:75427606-75431829 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 105242176

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 1078402763.

9030619P08Rik - Estrogen effect on male and female haematopoietic stem cells

Annotation:: 9030619P08Rik, lymphocyte antigen 6 complex pseudogene

Organism:: Mus musculus

Reporter:: GPL6246, 10429588 (ID_REF), GDS4944, NR_108041, BC087965, BC147461, BC147464, chr15:75427606-75431829 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 107840276

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 1017511764.

9030619P08Rik - Hematopoietic cell response to Xist deficiency in females: time course

Annotation:: 9030619P08Rik, lymphocyte antigen 6 complex pseudogene

Organism:: Mus musculus

Reporter:: GPL6246, 10429588 (ID_REF), GDS4755, NR_108041, BC087965, BC147461, BC147464, chr15:75427606-75431829 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 20 samples

ID:: 101751176

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 74683645.

9030619P08Rik - MPSS transcriptome analysis project

Annotation:: 9030619P08Rik, lymphocyte antigen 6 complex pseudogene

Organism:: Mus musculus

Reporter:: GPL1010, GATCCTGGATGCTACTGTCA (ID_REF), GDS868, BC087965

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7468364

GEO DataSets Gene Chromosome neighbors

Select item 1253397766.

9030619P08Rik - Core binding factor β deficiency effect on bone marrow derived-LSK hematopoietic stem cells

Annotation:: 9030619P08Rik, lymphocyte antigen 6 complex pseudogene

Organism:: Mus musculus

Reporter:: GPL6246, 10429588 (ID_REF), GDS5413, NR_108041, BC087965, BC147461, BC147464, chr15:75427606-75431829 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 4 samples

ID:: 125339776

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 1068012767.

9030619P08Rik - Pancreatic cancer-induced cachexia model: muscle, liver and white adipose tissue

Annotation:: 9030619P08Rik, lymphocyte antigen 6 complex pseudogene

Organism:: Mus musculus

Reporter:: GPL6246, 10429588 (ID_REF), GDS4899, NR_108041, BC087965, BC147461, BC147464, chr15:75427606-75431829 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 18 samples

ID:: 106801276

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 1054855768.

9030619P08Rik - Streptozotocin induced type 1 diabetes: liver

Annotation:: 9030619P08Rik, lymphocyte antigen 6 complex pseudogene

Organism:: Mus musculus

Reporter:: GPL6246, 10429588 (ID_REF), GDS4845, NR_108041, BC087965, BC147461, BC147464, chr15:75427606-75431829 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 13 samples

ID:: 105485576

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 76060649.

9030619P08Rik - MPSS analysis of BLK CL.4 and liver cells

Annotation:: 9030619P08Rik, lymphocyte antigen 6 complex pseudogene

Organism:: Mus musculus

Reporter:: GPL1010, GATCCTGGATGCTACTGTCA (ID_REF), GDS878, BC087965

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7606064

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 9696567610.

9030619P08Rik - Lmna G609G knock-in model of Hutchinson-Gilford Progeria Syndrome: liver

Annotation:: 9030619P08Rik, lymphocyte antigen 6 complex pseudogene

Organism:: Mus musculus

Reporter:: GPL6246, 10429588 (ID_REF), GDS4490, NR_108041, BC087965, BC147461, BC147464, chr15:75427606-75431829 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 96965676

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 10292277611.

9030619P08Rik - Liver response to a high fat diet: time course

Annotation:: 9030619P08Rik, lymphocyte antigen 6 complex pseudogene

Organism:: Mus musculus

Reporter:: GPL6246, 10429588 (ID_REF), GDS4783, NR_108041, BC087965, BC147461, BC147464, chr15:75427606-75431829 (SPOT ID)

DataSet type:: Expression profiling by array, count, 36 samples

ID:: 102922776

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 9209257612.

9030619P08Rik - Conventionalization of germ-free C57BL/6 males: time course

Annotation:: 9030619P08Rik, lymphocyte antigen 6 complex pseudogene

Organism:: Mus musculus

Reporter:: GPL11533, 10429588 (ID_REF), GDS4319, BC087965, chr15:75258036-75262259 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 144 samples

ID:: 92092576

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 11387747613.

9030619P08Rik - Caspase-1 deficiency effect on fasted liver

Annotation:: 9030619P08Rik, lymphocyte antigen 6 complex pseudogene

Organism:: Mus musculus

Reporter:: GPL11533, 10429588 (ID_REF), GDS4922, BC087965, chr15:75258036-75262259 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 113877476

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 12233297614.

9030619P08Rik - Death receptor knockout effect on NEMO-deficient model of chronic liver disease

Annotation:: 9030619P08Rik, lymphocyte antigen 6 complex pseudogene

Organism:: Mus musculus

Reporter:: GPL6246, 10429588 (ID_REF), GDS5332, NR_108041, BC087965, BC147461, BC147464, chr15:75427606-75431829 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 11 samples

ID:: 122332976

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 11334307615.

9030619P08Rik - c-Jun N-terminal kinase-1 deletion effect on bile duct ligation model of liver fibrosis: time course

Annotation:: 9030619P08Rik, lymphocyte antigen 6 complex pseudogene

Organism:: Mus musculus

Reporter:: GPL11533, 10429588 (ID_REF), GDS4878, BC087965, chr15:75258036-75262259 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 24 samples

ID:: 113343076

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 11320477616.

9030619P08Rik - Fasting effect on vanin-1 depleted liver

Annotation:: 9030619P08Rik, lymphocyte antigen 6 complex pseudogene

Organism:: Mus musculus

Reporter:: GPL11533, 10429588 (ID_REF), GDS4872, BC087965, chr15:75258036-75262259 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 16 samples

ID:: 113204776

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 10418947617.

9030619P08Rik - SIRT3 deficient liver response to a high fat diet

Annotation:: 9030619P08Rik, lymphocyte antigen 6 complex pseudogene

Organism:: Mus musculus

Reporter:: GPL6246, 10429588 (ID_REF), GDS4817, NR_108041, BC087965, BC147461, BC147464, chr15:75427606-75431829 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 104189476

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 8121287618.

9030619P08Rik - Conditional GBA1 deletion model of Type 1 Gaucher Disease: liver and spleen

Annotation:: 9030619P08Rik, lymphocyte antigen 6 complex pseudogene

Organism:: Mus musculus

Reporter:: GPL6246, 10429588 (ID_REF), GDS4162, NR_108041, BC087965, BC147461, BC147464, chr15:75427606-75431829 (SPOT ID)

DataSet type:: Expression profiling by array, count, 7 samples

ID:: 81212876

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 12378437619.

9030619P08Rik - NF-kappaB subunit p65/RelA deficiency effect on hematopoietic stem cells

Annotation:: 9030619P08Rik, lymphocyte antigen 6 complex pseudogene

Organism:: Mus musculus

Reporter:: GPL6246, 10429588 (ID_REF), GDS5372, NR_108041, BC087965, BC147461, BC147464, chr15:75427606-75431829 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 123784376

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 12537647620.

9030619P08Rik - Core binding factor β deficiency effect on bone marrow derived-granulocyte macrophage progenitor cells

Annotation:: 9030619P08Rik, lymphocyte antigen 6 complex pseudogene

Organism:: Mus musculus

Reporter:: GPL6246, 10429588 (ID_REF), GDS5414, NR_108041, BC087965, BC147461, BC147464, chr15:75427606-75431829 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 4 samples

ID:: 125376476

GEO DataSets Gene Profile neighbors Chromosome neighbors

<< First< Prev

Page of 8

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 56789043) (155)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 1 to 20 of 155

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity