Skip to main page content
U.S. flag

An official website of the United States government

Dot gov

The .gov means it’s official.
Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

Https

The site is secure.
The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation

dbSNP Short Genetic Variations

Welcome to the Reference SNP (rs) Report

All alleles are reported in the Forward orientation. Click on the Variant Details tab for details on Genomic Placement, Gene, and Amino Acid changes. HGVS names are in the HGVS tab.

Reference SNP (rs) Report

This page reports data for a single dbSNP Reference SNP variation (RefSNP or rs) from the new redesigned dbSNP build.
Top of the page reports a concise summary for the rs, with more specific details included in the corresponding tabs below.
All alleles are reported in the Forward orientation. Use the Genomic View to inspect the nucleotides flanking the variant, and its neighbors.
For more information see Help documentation.

rs1486750605

Current Build 156

Released September 21, 2022

Organism
Homo sapiens
Position
chr19:1491569-1491599 (GRCh38.p14) Help

The anchor position for this RefSNP. Includes all nucleotides potentially affected by this change, thus it can differ from HGVS, which is right-shifted. See here for details.

Alleles
delA(C)4TCTCTAGCTTCCG(C)4TGGCC
Variation Type
Indel Insertion and Deletion
Frequency
delA(C)4TCTCTAGCTTCCG(C)4TGGCC=0.000004 (1/264690, TOPMED)
delA(C)4TCTCTAGCTTCCG(C)4TGGCC=0.00000 (0/14050, ALFA)
Clinical Significance
Not Reported in ClinVar
Gene : Consequence
REEP6 : Intron Variant
PCSK4 : 2KB Upstream Variant
Publications
0 citations
Genomic View
See rs on genome

ALFA Allele Frequency
The ALFA project provide aggregate allele frequency from dbGaP. More information is available on the project page including descriptions, data access, and terms of use.

Release Version: 20231103111315
Population Group Sample Size Ref Allele Alt Allele Ref HMOZ Alt HMOZ HTRZ HWEP
Total Global 14050 GGCCACCCCTCTCTAGCTTCCGCCCCTGGCC=1.00000 GGCC=0.00000 1.0 0.0 0.0 N/A
European Sub 9690 GGCCACCCCTCTCTAGCTTCCGCCCCTGGCC=1.0000 GGCC=0.0000 1.0 0.0 0.0 N/A
African Sub 2898 GGCCACCCCTCTCTAGCTTCCGCCCCTGGCC=1.0000 GGCC=0.0000 1.0 0.0 0.0 N/A
African Others Sub 114 GGCCACCCCTCTCTAGCTTCCGCCCCTGGCC=1.000 GGCC=0.000 1.0 0.0 0.0 N/A
African American Sub 2784 GGCCACCCCTCTCTAGCTTCCGCCCCTGGCC=1.0000 GGCC=0.0000 1.0 0.0 0.0 N/A
Asian Sub 112 GGCCACCCCTCTCTAGCTTCCGCCCCTGGCC=1.000 GGCC=0.000 1.0 0.0 0.0 N/A
East Asian Sub 86 GGCCACCCCTCTCTAGCTTCCGCCCCTGGCC=1.00 GGCC=0.00 1.0 0.0 0.0 N/A
Other Asian Sub 26 GGCCACCCCTCTCTAGCTTCCGCCCCTGGCC=1.00 GGCC=0.00 1.0 0.0 0.0 N/A
Latin American 1 Sub 146 GGCCACCCCTCTCTAGCTTCCGCCCCTGGCC=1.000 GGCC=0.000 1.0 0.0 0.0 N/A
Latin American 2 Sub 610 GGCCACCCCTCTCTAGCTTCCGCCCCTGGCC=1.000 GGCC=0.000 1.0 0.0 0.0 N/A
South Asian Sub 98 GGCCACCCCTCTCTAGCTTCCGCCCCTGGCC=1.00 GGCC=0.00 1.0 0.0 0.0 N/A
Other Sub 496 GGCCACCCCTCTCTAGCTTCCGCCCCTGGCC=1.000 GGCC=0.000 1.0 0.0 0.0 N/A


Help

Frequency tab displays a table of the reference and alternate allele frequencies reported by various studies and populations. Table lines, where Population="Global" refer to the entire study population, whereas lines, where Group="Sub", refer to a study-specific population subgroupings (i.e. AFR, CAU, etc.), if available. Frequency for the alternate allele (Alt Allele) is a ratio of samples observed-to-total, where the numerator (observed samples) is the number of chromosomes in the study with the minor allele present (found in "Sample size", where Group="Sub"), and the denominator (total samples) is the total number of all chromosomes in the study for the variant (found in "Sample size", where Group="Study-wide" and Population="Global").

Download
Study Population Group Sample Size Ref Allele Alt Allele
TopMed Global Study-wide 264690 GGCCA(C)4TCTCTAGCTTCCG(C)4TGGCC=0.999996 delA(C)4TCTCTAGCTTCCG(C)4TGGCC=0.000004
Allele Frequency Aggregator Total Global 14050 GGCCA(C)4TCTCTAGCTTCCG(C)4TGGCC=1.00000 delA(C)4TCTCTAGCTTCCG(C)4TGGCC=0.00000
Allele Frequency Aggregator European Sub 9690 GGCCA(C)4TCTCTAGCTTCCG(C)4TGGCC=1.0000 delA(C)4TCTCTAGCTTCCG(C)4TGGCC=0.0000
Allele Frequency Aggregator African Sub 2898 GGCCA(C)4TCTCTAGCTTCCG(C)4TGGCC=1.0000 delA(C)4TCTCTAGCTTCCG(C)4TGGCC=0.0000
Allele Frequency Aggregator Latin American 2 Sub 610 GGCCA(C)4TCTCTAGCTTCCG(C)4TGGCC=1.000 delA(C)4TCTCTAGCTTCCG(C)4TGGCC=0.000
Allele Frequency Aggregator Other Sub 496 GGCCA(C)4TCTCTAGCTTCCG(C)4TGGCC=1.000 delA(C)4TCTCTAGCTTCCG(C)4TGGCC=0.000
Allele Frequency Aggregator Latin American 1 Sub 146 GGCCA(C)4TCTCTAGCTTCCG(C)4TGGCC=1.000 delA(C)4TCTCTAGCTTCCG(C)4TGGCC=0.000
Allele Frequency Aggregator Asian Sub 112 GGCCA(C)4TCTCTAGCTTCCG(C)4TGGCC=1.000 delA(C)4TCTCTAGCTTCCG(C)4TGGCC=0.000
Allele Frequency Aggregator South Asian Sub 98 GGCCA(C)4TCTCTAGCTTCCG(C)4TGGCC=1.00 delA(C)4TCTCTAGCTTCCG(C)4TGGCC=0.00
Help

Variant Details tab shows known variant placements on genomic sequences: chromosomes (NC_), RefSeqGene, pseudogenes or genomic regions (NG_), and in a separate table: on transcripts (NM_) and protein sequences (NP_). The corresponding transcript and protein locations are listed in adjacent lines, along with molecular consequences from Sequence Ontology. When no protein placement is available, only the transcript is listed. Column "Codon[Amino acid]" shows the actual base change in the format of "Reference > Alternate" allele, including the nucleotide codon change in transcripts, and the amino acid change in proteins, respectively, allowing for known ribosomal slippage sites. To view nucleotides adjacent to the variant use the Genomic View at the bottom of the page - zoom into the sequence until the nucleotides around the variant become visible.

Genomic Placements
Sequence name Change
GRCh38.p14 chr 19 NC_000019.10:g.1491573_1491599del
GRCh37.p13 chr 19 NC_000019.9:g.1491572_1491598del
REEP6 RefSeqGene NG_055254.1:g.5569_5595del
Gene: REEP6, receptor accessory protein 6 (plus strand)
Molecule type Change Amino acid[Codon] SO Term
REEP6 transcript variant 1 NM_001329556.3:c.115+189_…

NM_001329556.3:c.115+189_115+215del

N/A Intron Variant
REEP6 transcript variant 2 NM_138393.4:c.115+189_115…

NM_138393.4:c.115+189_115+215del

N/A Intron Variant
Gene: PCSK4, proprotein convertase subtilisin/kexin type 4 (minus strand) : 2KB Upstream Variant
Molecule type Change Amino acid[Codon] SO Term
PCSK4 transcript variant 2 NM_001395257.1:c. N/A Upstream Transcript Variant
PCSK4 transcript variant 1 NM_017573.5:c. N/A Upstream Transcript Variant
PCSK4 transcript variant X1 XM_011528085.3:c. N/A Upstream Transcript Variant
PCSK4 transcript variant X2 XM_011528086.3:c. N/A Upstream Transcript Variant
PCSK4 transcript variant X4 XM_011528087.3:c. N/A Upstream Transcript Variant
PCSK4 transcript variant X5 XM_011528088.3:c. N/A Upstream Transcript Variant
PCSK4 transcript variant X6 XM_011528089.3:c. N/A Upstream Transcript Variant
PCSK4 transcript variant X7 XM_011528090.3:c. N/A Upstream Transcript Variant
PCSK4 transcript variant X8 XM_011528091.3:c. N/A Upstream Transcript Variant
PCSK4 transcript variant X9 XM_011528092.3:c. N/A Upstream Transcript Variant
PCSK4 transcript variant X12 XM_011528093.3:c. N/A Upstream Transcript Variant
PCSK4 transcript variant X17 XM_011528095.3:c. N/A Upstream Transcript Variant
PCSK4 transcript variant X15 XM_024451555.2:c. N/A Upstream Transcript Variant
PCSK4 transcript variant X23 XM_024451556.2:c. N/A Upstream Transcript Variant
PCSK4 transcript variant X3 XM_047438980.1:c. N/A Upstream Transcript Variant
PCSK4 transcript variant X10 XM_047438981.1:c. N/A Upstream Transcript Variant
PCSK4 transcript variant X11 XM_047438982.1:c. N/A Upstream Transcript Variant
PCSK4 transcript variant X14 XM_047438984.1:c. N/A Upstream Transcript Variant
PCSK4 transcript variant X16 XM_047438985.1:c. N/A Upstream Transcript Variant
PCSK4 transcript variant X18 XM_047438986.1:c. N/A Upstream Transcript Variant
PCSK4 transcript variant X19 XM_047438987.1:c. N/A Upstream Transcript Variant
PCSK4 transcript variant X20 XM_047438988.1:c. N/A Upstream Transcript Variant
PCSK4 transcript variant X21 XM_047438989.1:c. N/A Upstream Transcript Variant
PCSK4 transcript variant X22 XM_047438990.1:c. N/A Upstream Transcript Variant
PCSK4 transcript variant X13 XM_047438983.1:c. N/A N/A
PCSK4 transcript variant X24 XM_047438991.1:c. N/A N/A
Help

Clinical Significance tab shows a list of clinical significance entries from ClinVar associated with the variation, per allele. Click on the RCV accession (i.e. RCV000001615.2) or Allele ID (i.e. 12274) to access full ClinVar report.

Not Reported in ClinVar
Help

Aliases tab displays HGVS names representing the variant placements and allele changes on genomic, transcript and protein sequences, per allele. HGVS name is an expression for reporting sequence accession and version, sequence type, position, and allele change. The column "Note" can have two values: "diff" means that there is a difference between the reference allele (variation interval) at the placement reported in HGVS name and the reference alleles reported in other HGVS names, and "rev" means that the sequence of this variation interval at the placement reported in HGVS name is in reverse orientation to the sequence(s) of this variation in other HGVS names not labeled as "rev".

Placement GGCCA(C)4TCTCTAGCTTCCG(C)4TGGCC= delA(C)4TCTCTAGCTTCCG(C)4TGGCC
GRCh38.p14 chr 19 NC_000019.10:g.1491569_1491599= NC_000019.10:g.1491573_1491599del
GRCh37.p13 chr 19 NC_000019.9:g.1491568_1491598= NC_000019.9:g.1491572_1491598del
REEP6 RefSeqGene NG_055254.1:g.5565_5595= NG_055254.1:g.5569_5595del
REEP6 transcript variant 1 NM_001329556.3:c.115+185= NM_001329556.3:c.115+189_115+215del
REEP6 transcript NM_138393.1:c.115+185= NM_138393.1:c.115+189_115+215del
REEP6 transcript variant 2 NM_138393.4:c.115+185= NM_138393.4:c.115+189_115+215del
Help

Submissions tab displays variations originally submitted to dbSNP, now supporting this RefSNP cluster (rs). We display Submitter handle, Submission identifier, Date and Build number, when the submission appeared for the first time. Direct submissions to dbSNP have Submission ID in the form of an ss-prefixed number (ss#). Other supporting variations are listed in the table without ss#.

1 SubSNP, 2 Frequency submissions
No Submitter Submission ID Date (Build)
1 TOPMED ss5065503479 Apr 27, 2021 (155)
2 TopMed NC_000019.10 - 1491569 Apr 27, 2021 (155)
3 ALFA NC_000019.10 - 1491569 Apr 27, 2021 (155)
Help

History tab displays RefSNPs (Associated ID) from previous builds (Build) that now support the current RefSNP, and the dates, when the history was updated for each Associated ID (History Updated).

Added to this RefSNP Cluster:
Submission IDs Observation SPDI Canonical SPDI Source RSIDs
281049143, ss5065503479 NC_000019.10:1491568:GGCCACCCCTCTC…

NC_000019.10:1491568:GGCCACCCCTCTCTAGCTTCCGCCCCT:

NC_000019.10:1491568:GGCCACCCCTCTC…

NC_000019.10:1491568:GGCCACCCCTCTCTAGCTTCCGCCCCTGGCC:GGCC

(self)
9984011640 NC_000019.10:1491568:GGCCACCCCTCTC…

NC_000019.10:1491568:GGCCACCCCTCTCTAGCTTCCGCCCCTGGCC:GGCC

NC_000019.10:1491568:GGCCACCCCTCTC…

NC_000019.10:1491568:GGCCACCCCTCTCTAGCTTCCGCCCCTGGCC:GGCC

(self)
Help

Publications tab displays PubMed articles citing the variation as a listing of PMID, Title, Author, Year, Journal, ordered by Year, descending.

No publications for rs1486750605

Help

The Flanks tab provides retrieving flanking sequences of a SNP on all molecules that have placements.

Genome context:
Select flank length:

Genomic regions, transcripts, and products
Top Help

NCBI Graphical Sequence Viewer display of the genomic region, transcripts and protein products for the reported RefSNP (rs).
Use the zoom option to view the nucleotides around the RefSNP and find other neighboring RefSNPs.
Visit Sequence Viewer for help with navigating inside the display and modifying the selection of displayed data tracks.

Software version is: 2.0.1.post820+afb47a3d