Skip to main page content
U.S. flag

An official website of the United States government

Dot gov

The .gov means it’s official.
Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

Https

The site is secure.
The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation

dbSNP Short Genetic Variations

Welcome to the Reference SNP (rs) Report

All alleles are reported in the Forward orientation. Click on the Variant Details tab for details on Genomic Placement, Gene, and Amino Acid changes. HGVS names are in the HGVS tab.

Reference SNP (rs) Report

This page reports data for a single dbSNP Reference SNP variation (RefSNP or rs) from the new redesigned dbSNP build.
Top of the page reports a concise summary for the rs, with more specific details included in the corresponding tabs below.
All alleles are reported in the Forward orientation. Use the Genomic View to inspect the nucleotides flanking the variant, and its neighbors.
For more information see Help documentation.

rs1491305651

Current Build 156

Released September 21, 2022

Organism
Homo sapiens
Position
chr19:13745692-13745693 (GRCh38.p14) Help

The anchor position for this RefSNP. Includes all nucleotides potentially affected by this change, thus it can differ from HGVS, which is right-shifted. See here for details.

Alleles
ins(GATA)4TCTA / ins(GATA)3TCTA / …

ins(GATA)4TCTA / ins(GATA)3TCTA / ins(GATA)2TCTA / insGATATCTA

Variation Type
Indel Insertion and Deletion
Frequency
ins(GATA)3TCTA=0.00000 (0/11844, ALFA)
ins(GATA)2TCTA=0.00000 (0/11844, ALFA)
insGATATCTA=0.00000 (0/11844, ALFA)
Clinical Significance
Not Reported in ClinVar
Gene : Consequence
YJU2B : Intron Variant
Publications
0 citations
Genomic View
See rs on genome

ALFA Allele Frequency
The ALFA project provide aggregate allele frequency from dbGaP. More information is available on the project page including descriptions, data access, and terms of use.

Release Version: 20231103111315
Population Group Sample Size Ref Allele Alt Allele Ref HMOZ Alt HMOZ HTRZ HWEP
Total Global 11844 TA=1.00000 TAGATAGATAGATATCTA=0.00000, TAGATAGATATCTA=0.00000, TAGATATCTA=0.00000 1.0 0.0 0.0 N/A
European Sub 7618 TA=1.0000 TAGATAGATAGATATCTA=0.0000, TAGATAGATATCTA=0.0000, TAGATATCTA=0.0000 1.0 0.0 0.0 N/A
African Sub 2800 TA=1.0000 TAGATAGATAGATATCTA=0.0000, TAGATAGATATCTA=0.0000, TAGATATCTA=0.0000 1.0 0.0 0.0 N/A
African Others Sub 106 TA=1.000 TAGATAGATAGATATCTA=0.000, TAGATAGATATCTA=0.000, TAGATATCTA=0.000 1.0 0.0 0.0 N/A
African American Sub 2694 TA=1.0000 TAGATAGATAGATATCTA=0.0000, TAGATAGATATCTA=0.0000, TAGATATCTA=0.0000 1.0 0.0 0.0 N/A
Asian Sub 108 TA=1.000 TAGATAGATAGATATCTA=0.000, TAGATAGATATCTA=0.000, TAGATATCTA=0.000 1.0 0.0 0.0 N/A
East Asian Sub 84 TA=1.00 TAGATAGATAGATATCTA=0.00, TAGATAGATATCTA=0.00, TAGATATCTA=0.00 1.0 0.0 0.0 N/A
Other Asian Sub 24 TA=1.00 TAGATAGATAGATATCTA=0.00, TAGATAGATATCTA=0.00, TAGATATCTA=0.00 1.0 0.0 0.0 N/A
Latin American 1 Sub 146 TA=1.000 TAGATAGATAGATATCTA=0.000, TAGATAGATATCTA=0.000, TAGATATCTA=0.000 1.0 0.0 0.0 N/A
Latin American 2 Sub 608 TA=1.000 TAGATAGATAGATATCTA=0.000, TAGATAGATATCTA=0.000, TAGATATCTA=0.000 1.0 0.0 0.0 N/A
South Asian Sub 94 TA=1.00 TAGATAGATAGATATCTA=0.00, TAGATAGATATCTA=0.00, TAGATATCTA=0.00 1.0 0.0 0.0 N/A
Other Sub 470 TA=1.000 TAGATAGATAGATATCTA=0.000, TAGATAGATATCTA=0.000, TAGATATCTA=0.000 1.0 0.0 0.0 N/A


Help

Frequency tab displays a table of the reference and alternate allele frequencies reported by various studies and populations. Table lines, where Population="Global" refer to the entire study population, whereas lines, where Group="Sub", refer to a study-specific population subgroupings (i.e. AFR, CAU, etc.), if available. Frequency for the alternate allele (Alt Allele) is a ratio of samples observed-to-total, where the numerator (observed samples) is the number of chromosomes in the study with the minor allele present (found in "Sample size", where Group="Sub"), and the denominator (total samples) is the total number of all chromosomes in the study for the variant (found in "Sample size", where Group="Study-wide" and Population="Global").

Download
Study Population Group Sample Size Ref Allele Alt Allele
Allele Frequency Aggregator Total Global 11844 TA=1.00000 ins(GATA)3TCTA=0.00000, ins(GATA)2TCTA=0.00000, insGATATCTA=0.00000
Allele Frequency Aggregator European Sub 7618 TA=1.0000 ins(GATA)3TCTA=0.0000, ins(GATA)2TCTA=0.0000, insGATATCTA=0.0000
Allele Frequency Aggregator African Sub 2800 TA=1.0000 ins(GATA)3TCTA=0.0000, ins(GATA)2TCTA=0.0000, insGATATCTA=0.0000
Allele Frequency Aggregator Latin American 2 Sub 608 TA=1.000 ins(GATA)3TCTA=0.000, ins(GATA)2TCTA=0.000, insGATATCTA=0.000
Allele Frequency Aggregator Other Sub 470 TA=1.000 ins(GATA)3TCTA=0.000, ins(GATA)2TCTA=0.000, insGATATCTA=0.000
Allele Frequency Aggregator Latin American 1 Sub 146 TA=1.000 ins(GATA)3TCTA=0.000, ins(GATA)2TCTA=0.000, insGATATCTA=0.000
Allele Frequency Aggregator Asian Sub 108 TA=1.000 ins(GATA)3TCTA=0.000, ins(GATA)2TCTA=0.000, insGATATCTA=0.000
Allele Frequency Aggregator South Asian Sub 94 TA=1.00 ins(GATA)3TCTA=0.00, ins(GATA)2TCTA=0.00, insGATATCTA=0.00
Help

Variant Details tab shows known variant placements on genomic sequences: chromosomes (NC_), RefSeqGene, pseudogenes or genomic regions (NG_), and in a separate table: on transcripts (NM_) and protein sequences (NP_). The corresponding transcript and protein locations are listed in adjacent lines, along with molecular consequences from Sequence Ontology. When no protein placement is available, only the transcript is listed. Column "Codon[Amino acid]" shows the actual base change in the format of "Reference > Alternate" allele, including the nucleotide codon change in transcripts, and the amino acid change in proteins, respectively, allowing for known ribosomal slippage sites. To view nucleotides adjacent to the variant use the Genomic View at the bottom of the page - zoom into the sequence until the nucleotides around the variant become visible.

Genomic Placements
Sequence name Change
GRCh38.p14 chr 19 NC_000019.10:g.13745692_13745693TAGA[4]TATCTA[1]
GRCh38.p14 chr 19 NC_000019.10:g.13745692_13745693TAGA[3]TATCTA[1]
GRCh38.p14 chr 19 NC_000019.10:g.13745692_13745693TAGA[2]TATCTA[1]
GRCh38.p14 chr 19 NC_000019.10:g.13745693_13745694insGATATCTA
GRCh37.p13 chr 19 NC_000019.9:g.13856506_13856507TAGA[4]TATCTA[1]
GRCh37.p13 chr 19 NC_000019.9:g.13856506_13856507TAGA[3]TATCTA[1]
GRCh37.p13 chr 19 NC_000019.9:g.13856506_13856507TAGA[2]TATCTA[1]
GRCh37.p13 chr 19 NC_000019.9:g.13856507_13856508insGATATCTA
Gene: YJU2B, YJU2 splicing factor homolog B (plus strand)
Molecule type Change Amino acid[Codon] SO Term
YJU2B transcript variant 2 NM_001320561.2:c.-201-591…

NM_001320561.2:c.-201-5915_-201-5914insGATAGATAGATAGATATCTA

N/A Intron Variant
YJU2B transcript variant 3 NM_001320564.2:c.-201-591…

NM_001320564.2:c.-201-5915_-201-5914insGATAGATAGATAGATATCTA

N/A Intron Variant
YJU2B transcript variant 4 NM_001320565.2:c.-201-591…

NM_001320565.2:c.-201-5915_-201-5914insGATAGATAGATAGATATCTA

N/A Intron Variant
YJU2B transcript variant 5 NM_001320566.2:c.-725-591…

NM_001320566.2:c.-725-5915_-725-5914insGATAGATAGATAGATATCTA

N/A Intron Variant
YJU2B transcript variant 6 NM_001320567.2:c.-725-591…

NM_001320567.2:c.-725-5915_-725-5914insGATAGATAGATAGATATCTA

N/A Intron Variant
YJU2B transcript variant 7 NM_001320568.2:c. N/A Genic Upstream Transcript Variant
YJU2B transcript variant 8 NM_001320569.2:c. N/A Genic Upstream Transcript Variant
YJU2B transcript variant 1 NM_030818.4:c. N/A Genic Upstream Transcript Variant
YJU2B transcript variant X1 XM_005260086.5:c.-201-591…

XM_005260086.5:c.-201-5915_-201-5914insGATAGATAGATAGATATCTA

N/A Intron Variant
YJU2B transcript variant X3 XM_011528326.3:c. N/A Genic Upstream Transcript Variant
YJU2B transcript variant X2 XM_047439475.1:c. N/A Genic Upstream Transcript Variant
Help

Clinical Significance tab shows a list of clinical significance entries from ClinVar associated with the variation, per allele. Click on the RCV accession (i.e. RCV000001615.2) or Allele ID (i.e. 12274) to access full ClinVar report.

Not Reported in ClinVar
Help

Aliases tab displays HGVS names representing the variant placements and allele changes on genomic, transcript and protein sequences, per allele. HGVS name is an expression for reporting sequence accession and version, sequence type, position, and allele change. The column "Note" can have two values: "diff" means that there is a difference between the reference allele (variation interval) at the placement reported in HGVS name and the reference alleles reported in other HGVS names, and "rev" means that the sequence of this variation interval at the placement reported in HGVS name is in reverse orientation to the sequence(s) of this variation in other HGVS names not labeled as "rev".

Placement TA= ins(GATA)4TCTA ins(GATA)3TCTA ins(GATA)2TCTA insGATATCTA
GRCh38.p14 chr 19 NC_000019.10:g.13745692_13745693= NC_000019.10:g.13745692_13745693TAGA[4]TATCTA[1] NC_000019.10:g.13745692_13745693TAGA[3]TATCTA[1] NC_000019.10:g.13745692_13745693TAGA[2]TATCTA[1] NC_000019.10:g.13745693_13745694insGATATCTA
GRCh37.p13 chr 19 NC_000019.9:g.13856506_13856507= NC_000019.9:g.13856506_13856507TAGA[4]TATCTA[1] NC_000019.9:g.13856506_13856507TAGA[3]TATCTA[1] NC_000019.9:g.13856506_13856507TAGA[2]TATCTA[1] NC_000019.9:g.13856507_13856508insGATATCTA
YJU2B transcript variant 2 NM_001320561.2:c.-201-5916= NM_001320561.2:c.-201-5915_-201-5914insGATAGATAGATAGATATCTA NM_001320561.2:c.-201-5915_-201-5914insGATAGATAGATATCTA NM_001320561.2:c.-201-5915_-201-5914insGATAGATATCTA NM_001320561.2:c.-201-5915_-201-5914insGATATCTA
YJU2B transcript variant 3 NM_001320564.2:c.-201-5916= NM_001320564.2:c.-201-5915_-201-5914insGATAGATAGATAGATATCTA NM_001320564.2:c.-201-5915_-201-5914insGATAGATAGATATCTA NM_001320564.2:c.-201-5915_-201-5914insGATAGATATCTA NM_001320564.2:c.-201-5915_-201-5914insGATATCTA
YJU2B transcript variant 4 NM_001320565.2:c.-201-5916= NM_001320565.2:c.-201-5915_-201-5914insGATAGATAGATAGATATCTA NM_001320565.2:c.-201-5915_-201-5914insGATAGATAGATATCTA NM_001320565.2:c.-201-5915_-201-5914insGATAGATATCTA NM_001320565.2:c.-201-5915_-201-5914insGATATCTA
YJU2B transcript variant 5 NM_001320566.2:c.-725-5916= NM_001320566.2:c.-725-5915_-725-5914insGATAGATAGATAGATATCTA NM_001320566.2:c.-725-5915_-725-5914insGATAGATAGATATCTA NM_001320566.2:c.-725-5915_-725-5914insGATAGATATCTA NM_001320566.2:c.-725-5915_-725-5914insGATATCTA
YJU2B transcript variant 6 NM_001320567.2:c.-725-5916= NM_001320567.2:c.-725-5915_-725-5914insGATAGATAGATAGATATCTA NM_001320567.2:c.-725-5915_-725-5914insGATAGATAGATATCTA NM_001320567.2:c.-725-5915_-725-5914insGATAGATATCTA NM_001320567.2:c.-725-5915_-725-5914insGATATCTA
CCDC130 transcript variant X1 XM_005260085.1:c.-201-5916= XM_005260085.1:c.-201-5915_-201-5914insGATAGATAGATAGATATCTA XM_005260085.1:c.-201-5915_-201-5914insGATAGATAGATATCTA XM_005260085.1:c.-201-5915_-201-5914insGATAGATATCTA XM_005260085.1:c.-201-5915_-201-5914insGATATCTA
CCDC130 transcript variant X2 XM_005260086.1:c.-201-5916= XM_005260086.1:c.-201-5915_-201-5914insGATAGATAGATAGATATCTA XM_005260086.1:c.-201-5915_-201-5914insGATAGATAGATATCTA XM_005260086.1:c.-201-5915_-201-5914insGATAGATATCTA XM_005260086.1:c.-201-5915_-201-5914insGATATCTA
YJU2B transcript variant X1 XM_005260086.5:c.-201-5916= XM_005260086.5:c.-201-5915_-201-5914insGATAGATAGATAGATATCTA XM_005260086.5:c.-201-5915_-201-5914insGATAGATAGATATCTA XM_005260086.5:c.-201-5915_-201-5914insGATAGATATCTA XM_005260086.5:c.-201-5915_-201-5914insGATATCTA
CCDC130 transcript variant X3 XM_005260087.1:c.-201-5916= XM_005260087.1:c.-201-5915_-201-5914insGATAGATAGATAGATATCTA XM_005260087.1:c.-201-5915_-201-5914insGATAGATAGATATCTA XM_005260087.1:c.-201-5915_-201-5914insGATAGATATCTA XM_005260087.1:c.-201-5915_-201-5914insGATATCTA
CCDC130 transcript variant X4 XM_005260088.1:c.-201-5916= XM_005260088.1:c.-201-5915_-201-5914insGATAGATAGATAGATATCTA XM_005260088.1:c.-201-5915_-201-5914insGATAGATAGATATCTA XM_005260088.1:c.-201-5915_-201-5914insGATAGATATCTA XM_005260088.1:c.-201-5915_-201-5914insGATATCTA
Help

Submissions tab displays variations originally submitted to dbSNP, now supporting this RefSNP cluster (rs). We display Submitter handle, Submission identifier, Date and Build number, when the submission appeared for the first time. Direct submissions to dbSNP have Submission ID in the form of an ss-prefixed number (ss#). Other supporting variations are listed in the table without ss#.

6 SubSNP, 5 Frequency submissions
No Submitter Submission ID Date (Build)
1 GNOMAD ss4328090987 Apr 26, 2021 (155)
2 GNOMAD ss4328090988 Apr 26, 2021 (155)
3 GNOMAD ss4328090989 Apr 26, 2021 (155)
4 GNOMAD ss4328090990 Apr 26, 2021 (155)
5 HUGCELL_USP ss5499203598 Oct 16, 2022 (156)
6 SANFORD_IMAGENETICS ss5662026298 Oct 16, 2022 (156)
7 gnomAD - Genomes

Submission ignored due to conflicting rows:
Row 534800744 (NC_000019.10:13745691::TAGATAGATAGATAGATATC 8/54012)
Row 534800745 (NC_000019.10:13745691::TAGATAGATAGATATC 18/54010)
Row 534800746 (NC_000019.10:13745691::TAGATAGATATC 194/53988)...

- Apr 26, 2021 (155)
8 gnomAD - Genomes

Submission ignored due to conflicting rows:
Row 534800744 (NC_000019.10:13745691::TAGATAGATAGATAGATATC 8/54012)
Row 534800745 (NC_000019.10:13745691::TAGATAGATAGATATC 18/54010)
Row 534800746 (NC_000019.10:13745691::TAGATAGATATC 194/53988)...

- Apr 26, 2021 (155)
9 gnomAD - Genomes

Submission ignored due to conflicting rows:
Row 534800744 (NC_000019.10:13745691::TAGATAGATAGATAGATATC 8/54012)
Row 534800745 (NC_000019.10:13745691::TAGATAGATAGATATC 18/54010)
Row 534800746 (NC_000019.10:13745691::TAGATAGATATC 194/53988)...

- Apr 26, 2021 (155)
10 gnomAD - Genomes

Submission ignored due to conflicting rows:
Row 534800744 (NC_000019.10:13745691::TAGATAGATAGATAGATATC 8/54012)
Row 534800745 (NC_000019.10:13745691::TAGATAGATAGATATC 18/54010)
Row 534800746 (NC_000019.10:13745691::TAGATAGATATC 194/53988)...

- Apr 26, 2021 (155)
11 ALFA NC_000019.10 - 13745692 Apr 26, 2021 (155)
Help

History tab displays RefSNPs (Associated ID) from previous builds (Build) that now support the current RefSNP, and the dates, when the history was updated for each Associated ID (History Updated).

Added to this RefSNP Cluster:
Submission IDs Observation SPDI Canonical SPDI Source RSIDs
ss4328090987 NC_000019.10:13745691::TAGATAGATAG…

NC_000019.10:13745691::TAGATAGATAGATAGATATC

NC_000019.10:13745691:TA:TAGATAGAT…

NC_000019.10:13745691:TA:TAGATAGATAGATAGATATCTA

(self)
ss4328090988 NC_000019.10:13745691::TAGATAGATAG…

NC_000019.10:13745691::TAGATAGATAGATATC

NC_000019.10:13745691:TA:TAGATAGAT…

NC_000019.10:13745691:TA:TAGATAGATAGATATCTA

(self)
1341675049 NC_000019.10:13745691:TA:TAGATAGAT…

NC_000019.10:13745691:TA:TAGATAGATAGATATCTA

NC_000019.10:13745691:TA:TAGATAGAT…

NC_000019.10:13745691:TA:TAGATAGATAGATATCTA

(self)
ss5662026298 NC_000019.9:13856505::TAGATAGATATC NC_000019.10:13745691:TA:TAGATAGAT…

NC_000019.10:13745691:TA:TAGATAGATATCTA

ss4328090989, ss5499203598 NC_000019.10:13745691::TAGATAGATATC NC_000019.10:13745691:TA:TAGATAGAT…

NC_000019.10:13745691:TA:TAGATAGATATCTA

(self)
1341675049 NC_000019.10:13745691:TA:TAGATAGAT…

NC_000019.10:13745691:TA:TAGATAGATATCTA

NC_000019.10:13745691:TA:TAGATAGAT…

NC_000019.10:13745691:TA:TAGATAGATATCTA

(self)
ss4328090990 NC_000019.10:13745691::TAGATATC NC_000019.10:13745691:TA:TAGATATCTA (self)
1341675049 NC_000019.10:13745691:TA:TAGATATCTA NC_000019.10:13745691:TA:TAGATATCTA (self)
Help

Publications tab displays PubMed articles citing the variation as a listing of PMID, Title, Author, Year, Journal, ordered by Year, descending.

No publications for rs1491305651

Help

The Flanks tab provides retrieving flanking sequences of a SNP on all molecules that have placements.

Genome context:
Select flank length:

Genomic regions, transcripts, and products
Top Help

NCBI Graphical Sequence Viewer display of the genomic region, transcripts and protein products for the reported RefSNP (rs).
Use the zoom option to view the nucleotides around the RefSNP and find other neighboring RefSNPs.
Visit Sequence Viewer for help with navigating inside the display and modifying the selection of displayed data tracks.

Software version is: 2.0.1.post820+afb47a3d