Skip to main page content
U.S. flag

An official website of the United States government

Dot gov

The .gov means it’s official.
Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

Https

The site is secure.
The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation

dbSNP Short Genetic Variations

Welcome to the Reference SNP (rs) Report

All alleles are reported in the Forward orientation. Click on the Variant Details tab for details on Genomic Placement, Gene, and Amino Acid changes. HGVS names are in the HGVS tab.

Reference SNP (rs) Report

This page reports data for a single dbSNP Reference SNP variation (RefSNP or rs) from the new redesigned dbSNP build.
Top of the page reports a concise summary for the rs, with more specific details included in the corresponding tabs below.
All alleles are reported in the Forward orientation. Use the Genomic View to inspect the nucleotides flanking the variant, and its neighbors.
For more information see Help documentation.

rs1491382217

Current Build 156

Released September 21, 2022

Organism
Homo sapiens
Position
chr7:157480475-157480483 (GRCh38.p14) Help

The anchor position for this RefSNP. Includes all nucleotides potentially affected by this change, thus it can differ from HGVS, which is right-shifted. See here for details.

Alleles
insTAGCAGTCTGTGGGT / insTAGCATCTGT…

insTAGCAGTCTGTGGGT / insTAGCATCTGTGGGT / insTAGCATTCTGTGGGT

Variation Type
Indel Insertion and Deletion
Frequency
insTAGCATTCTGTGGGT=0.49756 (6122/12304, 8.3KJPN)
insTAGCATTCTGTGGGT=0.06137 (728/11862, ALFA)
TCTGTGGGT=0.4115 (493/1198, Korea1K)
Clinical Significance
Not Reported in ClinVar
Gene : Consequence
LOC101927914 : Intron Variant
Publications
0 citations
Genomic View
See rs on genome

ALFA Allele Frequency
The ALFA project provide aggregate allele frequency from dbGaP. More information is available on the project page including descriptions, data access, and terms of use.

Release Version: 20231103111315
Population Group Sample Size Ref Allele Alt Allele Ref HMOZ Alt HMOZ HTRZ HWEP
Total Global 11862 TCTGTGGGT=0.93863 TCTGTGGGTTAGCATTCTGTGGGT=0.06137 0.877255 0.0 0.122745 14
European Sub 7618 TCTGTGGGT=0.9383 TCTGTGGGTTAGCATTCTGTGGGT=0.0617 0.876608 0.0 0.123392 9
African Sub 2816 TCTGTGGGT=0.9347 TCTGTGGGTTAGCATTCTGTGGGT=0.0653 0.869318 0.0 0.130682 4
African Others Sub 108 TCTGTGGGT=0.926 TCTGTGGGTTAGCATTCTGTGGGT=0.074 0.851852 0.0 0.148148 0
African American Sub 2708 TCTGTGGGT=0.9350 TCTGTGGGTTAGCATTCTGTGGGT=0.0650 0.870015 0.0 0.129985 4
Asian Sub 108 TCTGTGGGT=0.963 TCTGTGGGTTAGCATTCTGTGGGT=0.037 0.925926 0.0 0.074074 0
East Asian Sub 84 TCTGTGGGT=0.98 TCTGTGGGTTAGCATTCTGTGGGT=0.02 0.952381 0.0 0.047619 0
Other Asian Sub 24 TCTGTGGGT=0.92 TCTGTGGGTTAGCATTCTGTGGGT=0.08 0.833333 0.0 0.166667 0
Latin American 1 Sub 146 TCTGTGGGT=0.925 TCTGTGGGTTAGCATTCTGTGGGT=0.075 0.849315 0.0 0.150685 0
Latin American 2 Sub 610 TCTGTGGGT=0.956 TCTGTGGGTTAGCATTCTGTGGGT=0.044 0.911475 0.0 0.088525 0
South Asian Sub 94 TCTGTGGGT=0.96 TCTGTGGGTTAGCATTCTGTGGGT=0.04 0.914894 0.0 0.085106 0
Other Sub 470 TCTGTGGGT=0.940 TCTGTGGGTTAGCATTCTGTGGGT=0.060 0.880851 0.0 0.119149 1


Help

Frequency tab displays a table of the reference and alternate allele frequencies reported by various studies and populations. Table lines, where Population="Global" refer to the entire study population, whereas lines, where Group="Sub", refer to a study-specific population subgroupings (i.e. AFR, CAU, etc.), if available. Frequency for the alternate allele (Alt Allele) is a ratio of samples observed-to-total, where the numerator (observed samples) is the number of chromosomes in the study with the minor allele present (found in "Sample size", where Group="Sub"), and the denominator (total samples) is the total number of all chromosomes in the study for the variant (found in "Sample size", where Group="Study-wide" and Population="Global").

Download
Study Population Group Sample Size Ref Allele Alt Allele
8.3KJPN JAPANESE Study-wide 12304 -

No frequency provided

insTAGCATTCTGTGGGT=0.49756
Allele Frequency Aggregator Total Global 11862 TCTGTGGGT=0.93863 insTAGCATTCTGTGGGT=0.06137
Allele Frequency Aggregator European Sub 7618 TCTGTGGGT=0.9383 insTAGCATTCTGTGGGT=0.0617
Allele Frequency Aggregator African Sub 2816 TCTGTGGGT=0.9347 insTAGCATTCTGTGGGT=0.0653
Allele Frequency Aggregator Latin American 2 Sub 610 TCTGTGGGT=0.956 insTAGCATTCTGTGGGT=0.044
Allele Frequency Aggregator Other Sub 470 TCTGTGGGT=0.940 insTAGCATTCTGTGGGT=0.060
Allele Frequency Aggregator Latin American 1 Sub 146 TCTGTGGGT=0.925 insTAGCATTCTGTGGGT=0.075
Allele Frequency Aggregator Asian Sub 108 TCTGTGGGT=0.963 insTAGCATTCTGTGGGT=0.037
Allele Frequency Aggregator South Asian Sub 94 TCTGTGGGT=0.96 insTAGCATTCTGTGGGT=0.04
Korean Genome Project KOREAN Study-wide 1198 -

No frequency provided

insTAGCATTCTGTGGGT=0.5885
Help

Variant Details tab shows known variant placements on genomic sequences: chromosomes (NC_), RefSeqGene, pseudogenes or genomic regions (NG_), and in a separate table: on transcripts (NM_) and protein sequences (NP_). The corresponding transcript and protein locations are listed in adjacent lines, along with molecular consequences from Sequence Ontology. When no protein placement is available, only the transcript is listed. Column "Codon[Amino acid]" shows the actual base change in the format of "Reference > Alternate" allele, including the nucleotide codon change in transcripts, and the amino acid change in proteins, respectively, allowing for known ribosomal slippage sites. To view nucleotides adjacent to the variant use the Genomic View at the bottom of the page - zoom into the sequence until the nucleotides around the variant become visible.

Genomic Placements
Sequence name Change
GRCh38.p14 chr 7 NC_000007.14:g.157480483_157480484insTAGCAGTCTGTGGGT
GRCh38.p14 chr 7 NC_000007.14:g.157480483_157480484insTAGCATCTGTGGGT
GRCh38.p14 chr 7 NC_000007.14:g.157480483_157480484insTAGCATTCTGTGGGT
GRCh37.p13 chr 7 NC_000007.13:g.157273177_157273178insTAGCAGTCTGTGGGT
GRCh37.p13 chr 7 NC_000007.13:g.157273177_157273178insTAGCATCTGTGGGT
GRCh37.p13 chr 7 NC_000007.13:g.157273177_157273178insTAGCATTCTGTGGGT
Gene: LOC101927914, uncharacterized LOC101927914 (plus strand)
Molecule type Change Amino acid[Codon] SO Term
LOC101927914 transcript NR_110157.1:n. N/A Intron Variant
Help

Clinical Significance tab shows a list of clinical significance entries from ClinVar associated with the variation, per allele. Click on the RCV accession (i.e. RCV000001615.2) or Allele ID (i.e. 12274) to access full ClinVar report.

Not Reported in ClinVar
Help

Aliases tab displays HGVS names representing the variant placements and allele changes on genomic, transcript and protein sequences, per allele. HGVS name is an expression for reporting sequence accession and version, sequence type, position, and allele change. The column "Note" can have two values: "diff" means that there is a difference between the reference allele (variation interval) at the placement reported in HGVS name and the reference alleles reported in other HGVS names, and "rev" means that the sequence of this variation interval at the placement reported in HGVS name is in reverse orientation to the sequence(s) of this variation in other HGVS names not labeled as "rev".

Placement TCTGTGGGT= insTAGCAGTCTGTGGGT insTAGCATCTGTGGGT insTAGCATTCTGTGGGT
GRCh38.p14 chr 7 NC_000007.14:g.157480475_157480483= NC_000007.14:g.157480483_157480484insTAGCAGTCTGTGGGT NC_000007.14:g.157480483_157480484insTAGCATCTGTGGGT NC_000007.14:g.157480483_157480484insTAGCATTCTGTGGGT
GRCh37.p13 chr 7 NC_000007.13:g.157273169_157273177= NC_000007.13:g.157273177_157273178insTAGCAGTCTGTGGGT NC_000007.13:g.157273177_157273178insTAGCATCTGTGGGT NC_000007.13:g.157273177_157273178insTAGCATTCTGTGGGT
Help

Submissions tab displays variations originally submitted to dbSNP, now supporting this RefSNP cluster (rs). We display Submitter handle, Submission identifier, Date and Build number, when the submission appeared for the first time. Direct submissions to dbSNP have Submission ID in the form of an ss-prefixed number (ss#). Other supporting variations are listed in the table without ss#.

10 SubSNP, 5 Frequency submissions
No Submitter Submission ID Date (Build)
1 MCHAISSO ss3065168611 Jan 10, 2018 (151)
2 MCHAISSO ss3066181770 Jan 10, 2018 (151)
3 BEROUKHIMLAB ss3644253123 Oct 12, 2018 (152)
4 KOGIC ss3962988575 Apr 26, 2020 (154)
5 TOMMO_GENOMICS ss5186530871 Apr 26, 2021 (155)
6 SANFORD_IMAGENETICS ss5644412191 Oct 13, 2022 (156)
7 TOMMO_GENOMICS ss5727824838 Oct 13, 2022 (156)
8 TOMMO_GENOMICS ss5727824839 Oct 13, 2022 (156)
9 EVA ss5823813930 Oct 13, 2022 (156)
10 EVA ss5823813931 Oct 13, 2022 (156)
11 Korean Genome Project NC_000007.14 - 157480475 Apr 26, 2020 (154)
12 8.3KJPN NC_000007.13 - 157273169 Apr 26, 2021 (155)
13 14KJPN

Submission ignored due to conflicting rows:
Row 61661942 (NC_000007.14:157480474::TCTGTGGGTTAGCAT 12091/26878)
Row 61661943 (NC_000007.14:157480474::TCTGTGGGTTAGCAG 1/26878)

- Oct 13, 2022 (156)
14 14KJPN

Submission ignored due to conflicting rows:
Row 61661942 (NC_000007.14:157480474::TCTGTGGGTTAGCAT 12091/26878)
Row 61661943 (NC_000007.14:157480474::TCTGTGGGTTAGCAG 1/26878)

- Oct 13, 2022 (156)
15 ALFA NC_000007.14 - 157480475 Apr 26, 2021 (155)
Help

History tab displays RefSNPs (Associated ID) from previous builds (Build) that now support the current RefSNP, and the dates, when the history was updated for each Associated ID (History Updated).

Added to this RefSNP Cluster:
Submission IDs Observation SPDI Canonical SPDI Source RSIDs
ss5727824839 NC_000007.14:157480474::TCTGTGGGTT…

NC_000007.14:157480474::TCTGTGGGTTAGCAG

NC_000007.14:157480474:TCTGTGGGT:T…

NC_000007.14:157480474:TCTGTGGGT:TCTGTGGGTTAGCAGTCTGTGGGT

ss5823813931 NC_000007.13:157273168::TCTGTGGGTT…

NC_000007.13:157273168::TCTGTGGGTTAGCA

NC_000007.14:157480474:TCTGTGGGT:T…

NC_000007.14:157480474:TCTGTGGGT:TCTGTGGGTTAGCATCTGTGGGT

44500178, ss3644253123, ss5186530871, ss5644412191, ss5823813930 NC_000007.13:157273168::TCTGTGGGTT…

NC_000007.13:157273168::TCTGTGGGTTAGCAT

NC_000007.14:157480474:TCTGTGGGT:T…

NC_000007.14:157480474:TCTGTGGGT:TCTGTGGGTTAGCATTCTGTGGGT

(self)
19366576, ss3065168611, ss3066181770, ss3962988575, ss5727824838 NC_000007.14:157480474::TCTGTGGGTT…

NC_000007.14:157480474::TCTGTGGGTTAGCAT

NC_000007.14:157480474:TCTGTGGGT:T…

NC_000007.14:157480474:TCTGTGGGT:TCTGTGGGTTAGCATTCTGTGGGT

(self)
3907094959 NC_000007.14:157480474:TCTGTGGGT:T…

NC_000007.14:157480474:TCTGTGGGT:TCTGTGGGTTAGCATTCTGTGGGT

NC_000007.14:157480474:TCTGTGGGT:T…

NC_000007.14:157480474:TCTGTGGGT:TCTGTGGGTTAGCATTCTGTGGGT

(self)
Help

Publications tab displays PubMed articles citing the variation as a listing of PMID, Title, Author, Year, Journal, ordered by Year, descending.

No publications for rs1491382217

Help

The Flanks tab provides retrieving flanking sequences of a SNP on all molecules that have placements.

Genome context:
Select flank length:

Genomic regions, transcripts, and products
Top Help

NCBI Graphical Sequence Viewer display of the genomic region, transcripts and protein products for the reported RefSNP (rs).
Use the zoom option to view the nucleotides around the RefSNP and find other neighboring RefSNPs.
Visit Sequence Viewer for help with navigating inside the display and modifying the selection of displayed data tracks.

Software version is: 2.0.1.post820+afb47a3d