Skip to main page content
U.S. flag

An official website of the United States government

Dot gov

The .gov means it’s official.
Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

Https

The site is secure.
The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation

dbSNP Short Genetic Variations

Welcome to the Reference SNP (rs) Report

All alleles are reported in the Forward orientation. Click on the Variant Details tab for details on Genomic Placement, Gene, and Amino Acid changes. HGVS names are in the HGVS tab.

Reference SNP (rs) Report

This page reports data for a single dbSNP Reference SNP variation (RefSNP or rs) from the new redesigned dbSNP build.
Top of the page reports a concise summary for the rs, with more specific details included in the corresponding tabs below.
All alleles are reported in the Forward orientation. Use the Genomic View to inspect the nucleotides flanking the variant, and its neighbors.
For more information see Help documentation.

rs1491498682

Current Build 156

Released September 21, 2022

Organism
Homo sapiens
Position
chr10:124507797 (GRCh38.p14) Help

The anchor position for this RefSNP. Includes all nucleotides potentially affected by this change, thus it can differ from HGVS, which is right-shifted. See here for details.

Alleles
insTG / insT(G)4TAGACAGGATTTCAGGTG
Variation Type
Indel Insertion and Deletion
Frequency
insTG=0.00000 (0/11522, ALFA)
insT(G)4TAGACAGGATTTCAGGTG=0.0001 (1/7520, 14KJPN)
Clinical Significance
Not Reported in ClinVar
Gene : Consequence
LHPP : Intron Variant
Publications
0 citations
Genomic View
See rs on genome

ALFA Allele Frequency
The ALFA project provide aggregate allele frequency from dbGaP. More information is available on the project page including descriptions, data access, and terms of use.

Release Version: 20231103111315
Population Group Sample Size Ref Allele Alt Allele Ref HMOZ Alt HMOZ HTRZ HWEP
Total Global 11522 G=1.00000 GTG=0.00000 1.0 0.0 0.0 N/A
European Sub 7350 G=1.0000 GTG=0.0000 1.0 0.0 0.0 N/A
African Sub 2764 G=1.0000 GTG=0.0000 1.0 0.0 0.0 N/A
African Others Sub 106 G=1.000 GTG=0.000 1.0 0.0 0.0 N/A
African American Sub 2658 G=1.0000 GTG=0.0000 1.0 0.0 0.0 N/A
Asian Sub 106 G=1.000 GTG=0.000 1.0 0.0 0.0 N/A
East Asian Sub 84 G=1.00 GTG=0.00 1.0 0.0 0.0 N/A
Other Asian Sub 22 G=1.00 GTG=0.00 1.0 0.0 0.0 N/A
Latin American 1 Sub 144 G=1.000 GTG=0.000 1.0 0.0 0.0 N/A
Latin American 2 Sub 606 G=1.000 GTG=0.000 1.0 0.0 0.0 N/A
South Asian Sub 94 G=1.00 GTG=0.00 1.0 0.0 0.0 N/A
Other Sub 458 G=1.000 GTG=0.000 1.0 0.0 0.0 N/A


Help

Frequency tab displays a table of the reference and alternate allele frequencies reported by various studies and populations. Table lines, where Population="Global" refer to the entire study population, whereas lines, where Group="Sub", refer to a study-specific population subgroupings (i.e. AFR, CAU, etc.), if available. Frequency for the alternate allele (Alt Allele) is a ratio of samples observed-to-total, where the numerator (observed samples) is the number of chromosomes in the study with the minor allele present (found in "Sample size", where Group="Sub"), and the denominator (total samples) is the total number of all chromosomes in the study for the variant (found in "Sample size", where Group="Study-wide" and Population="Global").

Download
Study Population Group Sample Size Ref Allele Alt Allele
Allele Frequency Aggregator Total Global 11522 G=1.00000 insTG=0.00000
Allele Frequency Aggregator European Sub 7350 G=1.0000 insTG=0.0000
Allele Frequency Aggregator African Sub 2764 G=1.0000 insTG=0.0000
Allele Frequency Aggregator Latin American 2 Sub 606 G=1.000 insTG=0.000
Allele Frequency Aggregator Other Sub 458 G=1.000 insTG=0.000
Allele Frequency Aggregator Latin American 1 Sub 144 G=1.000 insTG=0.000
Allele Frequency Aggregator Asian Sub 106 G=1.000 insTG=0.000
Allele Frequency Aggregator South Asian Sub 94 G=1.00 insTG=0.00
14KJPN JAPANESE Study-wide 7520 -

No frequency provided

insT(G)4TAGACAGGATTTCAGGTG=0.0001
Help

Variant Details tab shows known variant placements on genomic sequences: chromosomes (NC_), RefSeqGene, pseudogenes or genomic regions (NG_), and in a separate table: on transcripts (NM_) and protein sequences (NP_). The corresponding transcript and protein locations are listed in adjacent lines, along with molecular consequences from Sequence Ontology. When no protein placement is available, only the transcript is listed. Column "Codon[Amino acid]" shows the actual base change in the format of "Reference > Alternate" allele, including the nucleotide codon change in transcripts, and the amino acid change in proteins, respectively, allowing for known ribosomal slippage sites. To view nucleotides adjacent to the variant use the Genomic View at the bottom of the page - zoom into the sequence until the nucleotides around the variant become visible.

Genomic Placements
Sequence name Change
GRCh38.p14 chr 10 NC_000010.11:g.124507797_124507798insTG
GRCh38.p14 chr 10 NC_000010.11:g.124507797_124507798insTGGGGTAGACAGGATTTCAGGTG
GRCh37.p13 chr 10 NC_000010.10:g.126196366_126196367insTG
GRCh37.p13 chr 10 NC_000010.10:g.126196366_126196367insTGGGGTAGACAGGATTTCAGGTG
Gene: LHPP, phospholysine phosphohistidine inorganic pyrophosphate phosphatase (plus strand)
Molecule type Change Amino acid[Codon] SO Term
LHPP transcript variant 2 NM_001167880.2:c.624+9669…

NM_001167880.2:c.624+9669_624+9670insTG

N/A Intron Variant
LHPP transcript variant 3 NM_001318331.2:c.467+1922…

NM_001318331.2:c.467+19222_467+19223insTG

N/A Intron Variant
LHPP transcript variant 1 NM_022126.4:c.625-9383_62…

NM_022126.4:c.625-9383_625-9382insTG

N/A Intron Variant
LHPP transcript variant 4 NM_001318332.2:c. N/A Genic Downstream Transcript Variant
LHPP transcript variant X2 XM_005270026.4:c.625-9383…

XM_005270026.4:c.625-9383_625-9382insTG

N/A Intron Variant
LHPP transcript variant X4 XM_011540058.4:c.625-1421…

XM_011540058.4:c.625-1421_625-1420insTG

N/A Intron Variant
LHPP transcript variant X1 XM_017016509.2:c.625-9383…

XM_017016509.2:c.625-9383_625-9382insTG

N/A Intron Variant
LHPP transcript variant X3 XM_024448122.1:c.625-9383…

XM_024448122.1:c.625-9383_625-9382insTG

N/A Intron Variant
LHPP transcript variant X6 XM_017016512.2:c. N/A Genic Upstream Transcript Variant
LHPP transcript variant X5 XR_001747177.3:n. N/A Intron Variant
Help

Clinical Significance tab shows a list of clinical significance entries from ClinVar associated with the variation, per allele. Click on the RCV accession (i.e. RCV000001615.2) or Allele ID (i.e. 12274) to access full ClinVar report.

Not Reported in ClinVar
Help

Aliases tab displays HGVS names representing the variant placements and allele changes on genomic, transcript and protein sequences, per allele. HGVS name is an expression for reporting sequence accession and version, sequence type, position, and allele change. The column "Note" can have two values: "diff" means that there is a difference between the reference allele (variation interval) at the placement reported in HGVS name and the reference alleles reported in other HGVS names, and "rev" means that the sequence of this variation interval at the placement reported in HGVS name is in reverse orientation to the sequence(s) of this variation in other HGVS names not labeled as "rev".

Placement G= insTG insT(G)4TAGACAGGATTTCAGGTG
GRCh38.p14 chr 10 NC_000010.11:g.124507797= NC_000010.11:g.124507797_124507798insTG NC_000010.11:g.124507797_124507798insTGGGGTAGACAGGATTTCAGGTG
GRCh37.p13 chr 10 NC_000010.10:g.126196366= NC_000010.10:g.126196366_126196367insTG NC_000010.10:g.126196366_126196367insTGGGGTAGACAGGATTTCAGGTG
LHPP transcript variant 2 NM_001167880.1:c.624+9669= NM_001167880.1:c.624+9669_624+9670insTG NM_001167880.1:c.624+9669_624+9670insTGGGGTAGACAGGATTTCAGGTG
LHPP transcript variant 2 NM_001167880.2:c.624+9669= NM_001167880.2:c.624+9669_624+9670insTG NM_001167880.2:c.624+9669_624+9670insTGGGGTAGACAGGATTTCAGGTG
LHPP transcript variant 3 NM_001318331.2:c.467+19222= NM_001318331.2:c.467+19222_467+19223insTG NM_001318331.2:c.467+19222_467+19223insTGGGGTAGACAGGATTTCAGGTG
LHPP transcript variant 1 NM_022126.3:c.625-9383= NM_022126.3:c.625-9383_625-9382insTG NM_022126.3:c.625-9383_625-9382insTGGGGTAGACAGGATTTCAGGTG
LHPP transcript variant 1 NM_022126.4:c.625-9383= NM_022126.4:c.625-9383_625-9382insTG NM_022126.4:c.625-9383_625-9382insTGGGGTAGACAGGATTTCAGGTG
LHPP transcript variant X1 XM_005270025.1:c.625-9383= XM_005270025.1:c.625-9383_625-9382insTG XM_005270025.1:c.625-9383_625-9382insTGGGGTAGACAGGATTTCAGGTG
LHPP transcript variant X2 XM_005270026.1:c.625-9383= XM_005270026.1:c.625-9383_625-9382insTG XM_005270026.1:c.625-9383_625-9382insTGGGGTAGACAGGATTTCAGGTG
LHPP transcript variant X2 XM_005270026.4:c.625-9383= XM_005270026.4:c.625-9383_625-9382insTG XM_005270026.4:c.625-9383_625-9382insTGGGGTAGACAGGATTTCAGGTG
LHPP transcript variant X4 XM_011540058.4:c.625-1421= XM_011540058.4:c.625-1421_625-1420insTG XM_011540058.4:c.625-1421_625-1420insTGGGGTAGACAGGATTTCAGGTG
LHPP transcript variant X1 XM_017016509.2:c.625-9383= XM_017016509.2:c.625-9383_625-9382insTG XM_017016509.2:c.625-9383_625-9382insTGGGGTAGACAGGATTTCAGGTG
LHPP transcript variant X3 XM_024448122.1:c.625-9383= XM_024448122.1:c.625-9383_625-9382insTG XM_024448122.1:c.625-9383_625-9382insTGGGGTAGACAGGATTTCAGGTG
Help

Submissions tab displays variations originally submitted to dbSNP, now supporting this RefSNP cluster (rs). We display Submitter handle, Submission identifier, Date and Build number, when the submission appeared for the first time. Direct submissions to dbSNP have Submission ID in the form of an ss-prefixed number (ss#). Other supporting variations are listed in the table without ss#.

1 SubSNP, 2 Frequency submissions
No Submitter Submission ID Date (Build)
1 TOMMO_GENOMICS ss5746429763 Oct 16, 2022 (156)
2 14KJPN NC_000010.11 - 124507797 Oct 16, 2022 (156)
3 ALFA NC_000010.11 - 124507797 Apr 26, 2021 (155)
Help

History tab displays RefSNPs (Associated ID) from previous builds (Build) that now support the current RefSNP, and the dates, when the history was updated for each Associated ID (History Updated).

Added to this RefSNP Cluster:
Submission IDs Observation SPDI Canonical SPDI Source RSIDs
5078103902 NC_000010.11:124507796:G:GTG NC_000010.11:124507796:G:GTG (self)
80266867, ss5746429763 NC_000010.11:124507796::GTGGGGTAGA…

NC_000010.11:124507796::GTGGGGTAGACAGGATTTCAGGT

NC_000010.11:124507796:G:GTGGGGTAG…

NC_000010.11:124507796:G:GTGGGGTAGACAGGATTTCAGGTG

Removed from this RefSNP Cluster:
Submission IDs Observation SPDI Canonical SPDI Destination RSIDs
ss3132983171 NC_000010.11:124507796::GT NC_000010.11:124507796:G:GTG
Help

Publications tab displays PubMed articles citing the variation as a listing of PMID, Title, Author, Year, Journal, ordered by Year, descending.

No publications for rs1491498682

Help

The Flanks tab provides retrieving flanking sequences of a SNP on all molecules that have placements.

Genome context:
Select flank length:

Genomic regions, transcripts, and products
Top Help

NCBI Graphical Sequence Viewer display of the genomic region, transcripts and protein products for the reported RefSNP (rs).
Use the zoom option to view the nucleotides around the RefSNP and find other neighboring RefSNPs.
Visit Sequence Viewer for help with navigating inside the display and modifying the selection of displayed data tracks.

Software version is: 2.0.1.post820+afb47a3d