GEO DataSets

(Submitter supplied) Spotted amplified cDNA array on glass. 19200 spot corresponding to 14053 different genes. liver / fat / muscle / pituitary / hypothalamus / pineal / testis / ovary / oviduct / Oligo

Organism:

Gallus gallus

12 Series

321 Samples

Download data

(Submitter supplied) Spotted amplified cDNA array on glass. Produced with cDNA clones expressed in the chicken neuroendocrine system. Tissues used to produced the cDNA library included the hypothalamus, anterior pituitary gland, and pineal gland. 7200 spots Keywords = spotted Keywords = cDNA

Organism:

Gallus gallus

2 DataSets

2 Series

22 Samples

Download data

(Submitter supplied) Spotted amplified cDNA array on nylon membrane (8 x 12 cm). 3456 spots Keywords = spotted Keywords = cDNA

Organism:

Gallus gallus

Download data

(Submitter supplied) Spotted amplified cDNA array on glass. 7680 spots corresponding to 7435 genes from Liver and Adipose tissue.

Organism:

Gallus gallus

Download data

(Submitter supplied) From a set of 15 standard, normalized or full-length cDNA libraries, we generated 139 007 3'- or 5'-end sequenced ESTs, representing more than one-third of the c. 385 000 publicly available Populus ESTs. Clustering and assembly of 107 519 3'-end ESTs resulted in 14 451 contigs and 20 560 singletons, altogether representing 35 011 putative unique transcripts, or potentially more than three-quarters of the predicted c. more...

Organism:

Populus trichocarpa x Populus deltoides; Populus

Type:

Expression profiling by array

Platform:

GPL5921

10 Samples

Download data: TIFF

(Submitter supplied) Corning UltraGaps Protocol: The 15,496 clones from 14 poplar cDNA libraries (Ralph et al., 2006) were selected based on a CAP3 assembly (Huang and Madan, 1999; 95% identity and 40 bp overlap) of ca. 37,000 high-quality 3’ ESTs (i.e. longest available EST sequence from each putative unique transcript). Following in silico selection of candidates, clones were robotically rearrayed from daughter glycerol stock 384-well plates into 96-well plates prefilled with 7% glycerol in LB + ampicillin, incubated overnight at 37°C, and checked for uniform optical density. more...

Organism:

Populus

8 Series

158 Samples

Download data

(Submitter supplied) This is a chicken multi-tissue cDNA microarray with 12752 elements. It comprises clones from chicken EST collections generated by BBSRC, University of Delaware and the Fred Hutchinson Cancer Research Center. Sequence information is available from GenBank for all features on the array. Protocol: The clone-set was amplified in 96 well plates and re-arrayed into a 384-well Montage (Millipore) filtration plate to isolate the amplified DNA products. more...

Organism:

Gallus gallus

Download data

(Submitter supplied) Background The application of microarray technology to functional genomic analysis in the chicken has been limited by the lack of arrays containing large numbers of genes. Results We have produced cDNA arrays using chicken EST collections generated by BBSRC, University of Delaware and the Fred Hutchinson Cancer Research Center. From a total of 363,838 chicken ESTs representing 24 different adult or embryonic tissues, a set of 11,447 non-redundant ESTs were selected and added to an existing collection of clones (4,162) from immune tissues and a chicken bursal cell line (DT40). more...

Organism:

Gallus gallus

5 Series

60 Samples

Download data

(Submitter supplied) DNA Microarray construction : Gene expression analyses were carried out using home-made Nylon microarrays using a previously described technology [10441335]. These microarrays were built using as templates cDNA clones provided by the INRA-AGENAE program [16887034]. All these clones were PCR-amplified at the INRA Resources Centre for Animal Genomics (CRB GADIE, Jouy en Josas, France) using primers designed on the plasmid sequences flanking the cDNA inserts (M13RP1 5’- GTGGAATTGTGAGCGGATAAC and M13RP2 5’-GCAAGGCGATTAAGTTGGG). more...

Organism:

Oncorhynchus mykiss

1 Series

40 Samples

Download data

(Submitter supplied) We have designed and implemented a novel NimbleGen microarray platform capable of measuring global gene expression in Gossypium species. This custom designed microarray features ~60mer generic probes those were created by first assembling EST contigs from G.arboreum, G.raimondii, and G. hirsutum libraries and has the ability to measure total gene expression. Protocol: Oligonucleotide arrays were synthesized by NimbleGen Systems, Inc by maskless array synthesis using a digital micromirror array-mediated,parallel synthesis process incorporating 5'-photoprotected phosphoramidites. more...

Organism:

Gossypium

4 Series

93 Samples

Download data: NDF, NGD

(Submitter supplied) Initial test of the NBFGC cDNA microarray. Keywords = bovine, cDNA, microarray, false positive Keywords: repeat sample

Organism:

Bos taurus

Type:

Expression profiling by array

Platform:

GPL325

6 Samples

Download data

(Submitter supplied) series of experiments assesing false positive and background of pig brain library (PBL) microarray Keywords = porcine brain, pig brain Keywords: repeat sample

Organism:

Sus scrofa

Type:

Expression profiling by array

Platform:

GPL336

2 Samples

Download data

(Submitter supplied) Vocal learning and neuronal replacement have been studied extensively in the songbird brain, but until recently, few molecular and genomic tools have been available for this work. Here we describe new molecular/genomic resources for songbird research. We made cDNA libraries from zebra finch (Taeniopygia guttata) brains at different developmental stages. A total of 11000 clones were sequenced from these libraries, representing 5870 unique gene transcripts. more...

Organism:

Taeniopygia guttata; Serinus canaria

Type:

Expression profiling by array

Platform:

GPL4526

24 Samples

Download data

(Submitter supplied) van Hemert, S., B. H. Ebbelaar, M. A. Smits, and J. M. J. Rebel. 2003. Generation of EST and microarray resources for functional genomic studies on chicken intestinal health. Anim. Biotechnol. 14:133-143.

Organism:

Gallus gallus

2 Series

64 Samples

Download data

(Submitter supplied) spotted cDNA

Organism:

Mus musculus

1 Series

92 Samples

Download data

(Submitter supplied) spotted cDNA

Organism:

Mus musculus

1 Series

106 Samples

Download data

(Submitter supplied) spotted cDNA

Organism:

Mus musculus

1 Series

58 Samples

Download data

(Submitter supplied) Survey of relative gene expression profiles in larvae, pupae, and midguts and fatbodies of teneral, unfed, and fed adult mountain pine beetles from western Nevada, USA.

Organism:

Dendroctonus ponderosae

Type:

Expression profiling by array

Platform:

GPL9118

44 Samples

Download data: TXT

(Submitter supplied) These libraries represent total RNA from bursal tissue of 20 day old CB-inbred chicks and the ALV induced bursal cell line DT40 Cre1 cells. Keywords = chicken transcriptome SAGE Bursal cell DT40 Keywords: other

Organism:

Gallus gallus

Type:

Expression profiling by SAGE

Platform:

GPL1477

2 Samples

Download data

(Submitter supplied) 60-mer oligonucleotide probes were designed from EST contigs derived from Karenia brevis cDNA libraries using Array Designer v 4.0 following Agilent's recommendations for Tm, GC content, and position. Probes were submitted to Agilent's eArray website for randomization and addition of control probes. For details on printing see Agilent's website www.agilent.com. 60-mer oligonucleotide probes were designed from EST contigs derived from Karenia brevis cDNA libraries using Array Designer v 4.0 following Agilent's recommendations for Tm, GC content, and position. more...

Organism:

Karenia brevis

5 Series

78 Samples

Download data