|
| Status |
Public on May 10, 2013 |
| Title |
shScr Replicate 3 |
| Sample type |
RNA |
| |
|
| Source name |
LNCaP Cells
|
| Organism |
Homo sapiens |
| Characteristics |
cell line: LNCaP
transfected: pLKO.1 shScr
|
| Treatment protocol |
LNCaP cells infected in triplicate with three different shRNA lentiviruses, Two pLKO.1 constructs against ETV1 (ETV1sh1: TRCN0000013923, targeting GTGGGAGTAATCTAAACATTT in 39 UTR; and ETV1sh2: TRCN0000013925, targeting CGACCCAGTGTATGAACACAA in exon 7) were purchased from Open Biosystems and pLKO.1 shScr (targeting CCTAAGGTTAAGTCGCCCTCG) was purchased from Addgene. Three days after infection, RNA was harvested for expression profiling.
|
| Growth protocol |
LNCaP cells are growing logarithmically in RPMI with 10% fetal bovine serum.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
RNA is extracted using Rneasy per protocol. RNA quality was assessed using the Agilent 2100 Bioanalyzer and the RNA 6000 Nano kit (Agilent Technologies Inc., Palo Alto, CA).
|
| Label |
biotin
|
| Label protocol |
~500 ng of total RNA was used to prepare biotin-labeled RNA using Ambion Illumina TotalPrep RNA Amplification Kit (Cat# AMIL1791, Applied Biosystems, Foster City, CA). Briefly, 500 ng of total RNA was used to synthesize the first strand of cDNA using ArrayScript reverse transcriptase and an oligo(dT) primer bearing a T7 promoter. The single-stranded cDNA was then converted into a double-stranded DNA (dsDNA) by DNA polymerase^ I in the presence of /E. coli/ RNase H and DNA ligase. After column purification, the dsDNA was served as a template for in vitro transcription in a reaction containing biotin-labeled UTP, unlabeled NTPs and T7 RNA Polymerase.
|
| |
|
| Hybridization protocol |
The amplified, biotin-labeled antisense RNA (aRNA) was purified and quality was assessed using the Agilent 2100 Bioanalyzer and the RNA 6000 Nano kit. 750 ng of aRNA in 5 ul was mixed with 10 ul of hybridization reagents and heated at 65C for 10min. After cooled to room temperature, total 15 ul of the hyb solution was applied to Illumina MouseRef-8 v2 chip. The chip was incubated for about 18 hours at 58C.
|
| Scan protocol |
After washing and staining with streptavidin-Cy3, the chip was scanned using Illumina BeadArray Reader. The scanning was done using standard DirectHyb Gene Expression protocol with the following settings: Factor=1, PMT=587, Filter=100%.
|
| Data processing |
The raw data was extracted using Illumina BeadStudio software without normalization. Raw data was imported into Partek genomic suite.
|
| |
|
| Submission date |
Apr 23, 2013 |
| Last update date |
May 10, 2013 |
| Contact name |
Yu Chen |
| E-mail(s) |
[email protected]
|
| Phone |
646-888-3356
|
| Organization name |
Memorial Sloan Kettering Cancer Center
|
| Department |
Human Oncology and Pathogenesis Program
|
| Lab |
Chen
|
| Street address |
1275 York Ave, Box 20
|
| City |
New York |
| State/province |
NY |
| ZIP/Postal code |
10065 |
| Country |
USA |
| |
|
| Platform ID |
GPL6947 |
| Series (2) |
| GSE46329 |
Gene expression profile of ETV1 knockdown in LNCaP prostate cancer cells |
| GSE47220 |
ETS factors reprogram the androgen receptor cistrome and prime prostate tumorigenesis in response to PTEN loss |
|
