NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM1277965 Query DataSets for GSM1277965
Status Public on Feb 14, 2014
Title Acute Sal Rep1
Sample type SRA
 
Source name NAc dissection from 3-5 animals
Organism Mus musculus
Characteristics passages: 8-10 weeks
strain: C57BL/6
treatment: Repeated saline I.P. injection for 1w as control
Treatment protocol N/A
Growth protocol N/A
Extracted molecule total RNA
Extraction protocol following trizol RNA isolation protocol
Illumina RNA seq library prep kit
 
Library strategy RNA-Seq
Library source transcriptomic
Library selection cDNA
Instrument model Illumina HiSeq 2000
 
Data processing Basecalls performed using CASAVA
Adapter (AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGATCTCGTATGCCGTCTTCTGCTTG) sequences were removed from 3' end by fastx.
RNA-seq reads were aligned to the mm9 genome assembly using Tophat with options --frag-bias-correct and --multi-read-correct. Novel transcript assembly was not attempted.
Differential analysis was performed by Cuffdiff. An FDR<10% was used as cutoff.
Genome_build: Ensembl NCBIM37.62
Supplementary_files_format_and_content: acute_gene.diff file produced by Cuffdiff is a tab-delimited text file that contains the differential analysis information for each item tested.
 
Submission date Dec 03, 2013
Last update date May 15, 2019
Contact name Li Shen
E-mail(s) [email protected]
Organization name Icahn School of Medicine at Mount Sinai
Department Neuroscience
Lab Shen
Street address 1425 Madison Ave
City New York
State/province NY
ZIP/Postal code 10029
Country USA
 
Platform ID GPL13112
Series (2)
GSE42805 Chronic cocaine-regulated epigenome in mouse [RNA-Seq]
GSE42811 Chronic cocaine-regulated epigenome in mouse
Relations
BioSample SAMN02429245
SRA SRX386041

Supplementary data files not provided
SRA Run SelectorHelp
Raw data are available in SRA
Processed data are available on Series record

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap