|
Status |
Public on Feb 14, 2014 |
Title |
Acute Sal Rep1 |
Sample type |
SRA |
|
|
Source name |
NAc dissection from 3-5 animals
|
Organism |
Mus musculus |
Characteristics |
passages: 8-10 weeks strain: C57BL/6 treatment: Repeated saline I.P. injection for 1w as control
|
Treatment protocol |
N/A
|
Growth protocol |
N/A
|
Extracted molecule |
total RNA |
Extraction protocol |
following trizol RNA isolation protocol Illumina RNA seq library prep kit
|
|
|
Library strategy |
RNA-Seq |
Library source |
transcriptomic |
Library selection |
cDNA |
Instrument model |
Illumina HiSeq 2000 |
|
|
Data processing |
Basecalls performed using CASAVA Adapter (AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGATCTCGTATGCCGTCTTCTGCTTG) sequences were removed from 3' end by fastx. RNA-seq reads were aligned to the mm9 genome assembly using Tophat with options --frag-bias-correct and --multi-read-correct. Novel transcript assembly was not attempted. Differential analysis was performed by Cuffdiff. An FDR<10% was used as cutoff. Genome_build: Ensembl NCBIM37.62 Supplementary_files_format_and_content: acute_gene.diff file produced by Cuffdiff is a tab-delimited text file that contains the differential analysis information for each item tested.
|
|
|
Submission date |
Dec 03, 2013 |
Last update date |
May 15, 2019 |
Contact name |
Li Shen |
E-mail(s) |
[email protected]
|
Organization name |
Icahn School of Medicine at Mount Sinai
|
Department |
Neuroscience
|
Lab |
Shen
|
Street address |
1425 Madison Ave
|
City |
New York |
State/province |
NY |
ZIP/Postal code |
10029 |
Country |
USA |
|
|
Platform ID |
GPL13112 |
Series (2) |
GSE42805 |
Chronic cocaine-regulated epigenome in mouse [RNA-Seq] |
GSE42811 |
Chronic cocaine-regulated epigenome in mouse |
|
Relations |
BioSample |
SAMN02429245 |
SRA |
SRX386041 |