GEO Accession viewer

NCBI > GEO > Accession Display

Not logged in | Login

GEO help: Mouse over screen elements for information.

Sample GSM3186879

Query DataSets for GSM3186879

Status

Public on Sep 12, 2018

Title

No_61_pig_1758_ANTE

Sample type

SRA

Source name

heart

Organism

Sus scrofa

Characteristics

individual: Pig_1758
breed: Yorkshire-landrace
treatment: SHAM
tissue: anterior left ventricular wall
surgery_days_after_birth: Day14
harvest_after_treatment: 1W
rin: 8.4
library_prep_batch: 3
tissue: heart

Treatment protocol

Briefly, pigs were anesthetized, intubated, and maintained on a ventilator. A limited left lateral thoracotomy was performed to expose the heart. The branches of the left anterior descending coronary artery and left circumflex coronary arteries were permanently ligated to create an infarction. This consistently gives an infarct size of 15-20% of the left ventricular wall. Then the chest was closed. All animals received analgesia (Ketoprofen: 5 mg/kg/day), and antibiotics (Enrofloxacin: 15mg/kg) after surgery.

Growth protocol

Experiments were performed in Yorkshire-landrace swine on days 2 and 14 of age.

Extracted molecule

polyA RNA

Extraction protocol

Cardiac samples (50-80 mg/sample, n= 3 sham and 3 MI animals per condition) from anterior left ventricular wall of sham animals and of infarct zone and border zone of MI animal hearts were collected for RNA studies. Samples were cut into small pieces and immersed in RNAlater solution (Ambion, USA) for 48 hrs at 4°C. Then, tissue samples were homogenized and total RNA was isolated using RNAzol (Sigma-Aldrich, USA) and further purified by Purelink RNA kit (Ambion, USA).
RNA-seq libraries were prepared as previously described (PMID 29160304). Briefly, RNA was quantified using a Qubit RNA High-Sensitivity Assay kit (Life Technologies, USA) and assessed for degradation on the basis of their RNA integrity number using the LabChip GX microfluidics platform and RNA assay reagent kit (Perkin Elmer, USA). TruSeq Stranded mRNA Library Prep kit (Illumina, USA) was used or library preparation and libraries quantified using KAPA library quantification kits (KAPA Biosystems, USA) according to the manufacturer’s protocol. The quality and average fragment size of the final libraries were determined using a LabChip GX DNA High Sensitivity Reagent Kit (Perkin Elmer, USA). Libraries were sequenced on an Illumina NextSeq sequencer using 76bp Paired End chemistry.

Library strategy

RNA-Seq

Library source

transcriptomic

Library selection

cDNA

Instrument model

Illumina NextSeq 500

Description

Old Late Sham

Data processing

Sequenced libraries were demultiplexed using bcl2fastq v2.19.0.316 with the --no-lane-splitting option
Adapter sequences were then trimmed using trimmomatic v0.36 in paired end mode with the options MAXINFO:35:0.5 MINLEN:35. For reference, adapter sequences are AGATCGGAAGAGCACACGTCTGAACTCCAGTCA (read 1) and AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT (read 2)
Trimmed reads were aligned to the Sus scrofa 11.1 genome (Ensembl release 91) using STAR v. 2.2.1 with the options --outFilterType BySJout --outFilterMultimapNmax 20 --alignSJoverhangMin 8 --alignSJDBoverhangMin 1 --outFilterMismatchNmax 999 --alignIntronMin 20 --alignIntronMax 1000000 --alignMatesGapMax 1000000 in paired end, single pass mode
Only unique alignments were retained for counting. Counts were calculated at the gene level using the FeatureCounts module from subread v. 1.5.1, with the options -O -s 2 -J -T 8 -p -R -G.
Genome_build: Sus scrofa 11.1 (Ensembl release 91)
Supplementary_files_format_and_content: Gene-level counts calculated by FeatureCounts

Submission date

Jun 12, 2018

Last update date

Sep 12, 2018

Contact name

Giuseppe Alessandro D'Agostino

E-mail(s)

[email protected]

Organization name

Lee Kong Chian School of Medicine - NTU

Lab

Sarah Langley