|
| Status |
Public on May 11, 2020 |
| Title |
SATB1-SE_4C-seq_MED14-dTAG_2h_dTAG7_B |
| Sample type |
SRA |
| |
|
| Source name |
SATB1-SE_4C-seq_MED14-dTAG_2h_dTAG7
|
| Organism |
Homo sapiens |
| Characteristics |
cell line: KBM7
cell type: chronic myeloid leukemia cell line
genotype/variation: MED14-dTAG
treatment: 2h 500nM dTAG7
viewpoint annotation: SATB1_SE
restriction enzymes: NlaIII - DpnII
viewpoint forward primer: GTGGACTGAGGGGGTACATG
viewpoint reverse primer: GTTAGAACCAGGTACTGCCA
|
| Treatment protocol |
15mio cells were treated for 2h with 500nM dTAG7 or DMSO and then fixed with 1% MeOH-free PFA for 10min at room temperature.
|
| Growth protocol |
KBM7 cells were grown in IMDM medium supplemented with 10% FBS and 1% Pen/Strep.
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
Chromatin contacts for 4C libraries were generated as previously described (PMID: 22961246).
Viewpoint fragments were amplified using indicated primers. Sequencing-compatible overhangs were introduced by a second PCR reaction.
|
| |
|
| Library strategy |
OTHER |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Description |
mpimg_L17087-1_DH-DNA-011_S11
|
| Data processing |
Reads were kept if the nucleotides 1-16 had a hamming distance of at most 2 with the read primer nucleotides 1 to 16 and if the restriction enzyme cut site (nt 17-20) had also at most a hamming distance of 2. The read primer was removed from the raw reads and output.
Duplicate reads were collapsed and the restriction enzyme recognition site was added again at the beginning of a collapsed read.
The collapsed reads were then mapped with bowtie (v. 1.2.3) to the human genome (hg19) with parameters -n 2 -e 70 -m 1 -k 1 --best -l 200. This output only unique mapping reads with at most 2 mismatches.
The genome was insilico digested with the respective two restriction enzymes used for each 4C-experiment. Only reads are kept that either mapped to nonblind fragments or so called halfblind fragments. Nonblind fragments had both restriction enzyme cut sites present, one at each end. Halfblind fragments had only the first restriction enzyme present at both ends.
Then, bamtools merge (version 2.5.1) was used to merge all nonblind and halfblind files from the three biological replicates.
Genome_build: hg19
Supplementary_files_format_and_content: bigWig generation: bamCoverage (version 3.2.1) with options --normalizeUsing CPM --binSize 500 --smoothLength 6500 was used to create the final bigwig files.
|
| |
|
| Submission date |
Oct 28, 2019 |
| Last update date |
May 12, 2020 |
| Contact name |
Georg E Winter |
| Organization name |
CeMM - Research Institute for Molecular Medicine of the Austrian Academy of Sciences
|
| Street address |
Lazarettgasse 14, AKH BT25.3
|
| City |
Wien |
| State/province |
Austria |
| ZIP/Postal code |
1090 |
| Country |
Austria |
| |
|
| Platform ID |
GPL18573 |
| Series (2) |
| GSE139464 |
Selective Mediator-dependence of cell type-specifying transcription [4C-seq] |
| GSE139468 |
Selective Mediator dependence of cell-type-specifying transcription |
|
| Relations |
| BioSample |
SAMN13139829 |
| SRA |
SRX7064286 |
