|
Status |
Public on Sep 03, 2024 |
Title |
RiboSeq_EV1 |
Sample type |
SRA |
|
|
Source name |
Ribo-seq of planktonic culture of Pseudomonas aeruginosa PA01 treated with 0.2% arabinose from 45 min after inoculation (OD of 0.05) to OD 0.5-0.7
|
Organism |
Pseudomonas aeruginosa PAO1 |
Characteristics |
cell line: pHERD20T strain: PA01
|
Treatment protocol |
Expression of pHERD20T based plasmids was induced with 0.2 % arabinose after 45 min of growth. Cells were harvested between OD600 of 0.5 - 0.7.
|
Growth protocol |
Bacterial cultures were grown in liquid LB supplemented with 400 µg/ml carbenicillin at 37 °C and 180 rpm. Cultures were inoculated with OD600 of 0.05.
|
Extracted molecule |
total RNA |
Extraction protocol |
For the isolation of ribosome protected RNA, bacterial cells were harvested by fast filtration and flash frozen in liquid nitrogen. Cell lysates were subjected to MNase digestion and subsequently separated into their different components by rate zonal centrifugation on a sucrose gradient. The fraction containing 70S ribosomes was collected and ribosome protected RNA was isolated with the Direct-zol™ Kit (Zymo Research). RNA fragments between 26 – 34 nt were extracted from denaturing 15% polyacrylamide gels and subjected to cDNA library preparation using the NEBNext® Small RNA Library Prep Set for Illumina® (New England Biolabs) following manufacturer´s instructions.
|
|
|
Library strategy |
OTHER |
Library source |
transcriptomic |
Library selection |
other |
Instrument model |
Illumina HiSeq 2500 |
|
|
Description |
ribosome protected RNA
|
Data processing |
Library strategy: Ribo-Seq RiboSeq clipping using cutadapt (AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC) bowtie -m 1 RNASeq Reference genome: NC_002516.2 (Pseudomonas aeruginosa PA01) bowtie --trim3 1 -m 1 RNASeq_repetition cutadapt --nextseq-trim=20 -g 'TTTTT;min_overlap=1' -G 'GGGGGGG;min_overlap=3' -m 36 Reference genome: NC_002516.2 (Pseudomonas aeruginosa PA01) bowtie2 --very-sensitive-local -I 100 -X 1200 Genome_build: Reference genome: NC_002516.2 (Pseudomonas aeruginosa PA01) Supplementary_files_format_and_content: contains RiboSeq_EV[1-2], RiboSeq_PleD[1-2], RNASeq_EV[1-2], and RNASeq_PleD[1-2] data Supplementary_files_format_and_content: contains RNASeq repetition samples Supplementary_files_format_and_content: raw count data
|
|
|
Submission date |
Sep 03, 2021 |
Last update date |
Sep 03, 2024 |
Contact name |
Matthias Preusse |
Organization name |
Helmholtz Centre for Infection Research
|
Street address |
Inhoffenstr. 7
|
City |
Braunschweig |
ZIP/Postal code |
38124 |
Country |
Germany |
|
|
Platform ID |
GPL18782 |
Series (1) |
GSE183394 |
Pseudomonas aeruginosa post-translational responses to elevated c-di-GMP levels |
|
Relations |
BioSample |
SAMN21216050 |
SRA |
SRX12008579 |