NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM5857044 Query DataSets for GSM5857044
Status Public on Sep 03, 2024
Title pleD_1
Sample type SRA
 
Source name RNA-seq of planktonic culture of Pseudomonas aeruginosa PA01 treated with 0.2% arabinose from 45 min after inoculation (OD of 0.05) to OD 1.5
Organism Pseudomonas aeruginosa PAO1
Characteristics cell line: pHERD20T:pleD*
strain: PA01
Treatment protocol Expression of pHERD20T based plasmids was induced with 0.2 % arabinose after 45 min of growth. Cells were harvested at indicated OD.
Growth protocol Bacterial cultures were grown in liquid LB supplemented with 400 µg/ml carbenicillin at 37 °C and 180 rpm. Cultures were inoculated with OD600 of 0.05.
Extracted molecule total RNA
Extraction protocol Total RNA was extracted by mixing bacterial cells 1:1 with RNAprotect Bacteria Reagent (Qiagen) and by using the RNeasy® Mini Kit (Qiagen) in combination with QIAshredderTM (Qiagen) according to the manufacturer’s instructions. Genomic DNA was removed by DNase treatment (DNA-free™ Kit DNase Treatment & Removal, ambion). Tag-seq was used for library preparation including rRNA removal by treatment with RiboZero (Illumina).
 
Library strategy RNA-Seq
Library source transcriptomic
Library selection cDNA
Instrument model Illumina HiSeq 2500
 
Description processed data file: rpg_table2.csv
Data processing RiboSeq
clipping using cutadapt (AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC)
Reference genome: NC_002516.2 (Pseudomonas aeruginosa PA01)
bowtie -m 1
RNASeq
Reference genome: NC_002516.2 (Pseudomonas aeruginosa PA01)
bowtie --trim3 1 -m 1
RNASeq_repetition
cutadapt --nextseq-trim=20 -g 'TTTTT;min_overlap=1' -G 'GGGGGGG;min_overlap=3' -m 36
Reference genome: NC_002516.2 (Pseudomonas aeruginosa PA01)
bowtie2 --very-sensitive-local -I 100 -X 1200
Supplementary_files_format_and_content: raw count data
 
Submission date Feb 02, 2022
Last update date Sep 03, 2024
Contact name Matthias Preusse
Organization name Helmholtz Centre for Infection Research
Street address Inhoffenstr. 7
City Braunschweig
ZIP/Postal code 38124
Country Germany
 
Platform ID GPL18782
Series (1)
GSE183394 Pseudomonas aeruginosa post-translational responses to elevated c-di-GMP levels
Relations
BioSample SAMN25597900
SRA SRX14023574

Supplementary data files not provided
SRA Run SelectorHelp
Raw data are available in SRA
Processed data are available on Series record

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap