|
Status |
Public on Sep 03, 2024 |
Title |
pleD_1 |
Sample type |
SRA |
|
|
Source name |
RNA-seq of planktonic culture of Pseudomonas aeruginosa PA01 treated with 0.2% arabinose from 45 min after inoculation (OD of 0.05) to OD 1.5
|
Organism |
Pseudomonas aeruginosa PAO1 |
Characteristics |
cell line: pHERD20T:pleD* strain: PA01
|
Treatment protocol |
Expression of pHERD20T based plasmids was induced with 0.2 % arabinose after 45 min of growth. Cells were harvested at indicated OD.
|
Growth protocol |
Bacterial cultures were grown in liquid LB supplemented with 400 µg/ml carbenicillin at 37 °C and 180 rpm. Cultures were inoculated with OD600 of 0.05.
|
Extracted molecule |
total RNA |
Extraction protocol |
Total RNA was extracted by mixing bacterial cells 1:1 with RNAprotect Bacteria Reagent (Qiagen) and by using the RNeasy® Mini Kit (Qiagen) in combination with QIAshredderTM (Qiagen) according to the manufacturer’s instructions. Genomic DNA was removed by DNase treatment (DNA-free™ Kit DNase Treatment & Removal, ambion). Tag-seq was used for library preparation including rRNA removal by treatment with RiboZero (Illumina).
|
|
|
Library strategy |
RNA-Seq |
Library source |
transcriptomic |
Library selection |
cDNA |
Instrument model |
Illumina HiSeq 2500 |
|
|
Description |
processed data file: rpg_table2.csv
|
Data processing |
RiboSeq clipping using cutadapt (AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC) Reference genome: NC_002516.2 (Pseudomonas aeruginosa PA01) bowtie -m 1 RNASeq Reference genome: NC_002516.2 (Pseudomonas aeruginosa PA01) bowtie --trim3 1 -m 1 RNASeq_repetition cutadapt --nextseq-trim=20 -g 'TTTTT;min_overlap=1' -G 'GGGGGGG;min_overlap=3' -m 36 Reference genome: NC_002516.2 (Pseudomonas aeruginosa PA01) bowtie2 --very-sensitive-local -I 100 -X 1200 Supplementary_files_format_and_content: raw count data
|
|
|
Submission date |
Feb 02, 2022 |
Last update date |
Sep 03, 2024 |
Contact name |
Matthias Preusse |
Organization name |
Helmholtz Centre for Infection Research
|
Street address |
Inhoffenstr. 7
|
City |
Braunschweig |
ZIP/Postal code |
38124 |
Country |
Germany |
|
|
Platform ID |
GPL18782 |
Series (1) |
GSE183394 |
Pseudomonas aeruginosa post-translational responses to elevated c-di-GMP levels |
|
Relations |
BioSample |
SAMN25597900 |
SRA |
SRX14023574 |