|
| Status |
Public on Sep 03, 2024 |
| Title |
pleD_2 |
| Sample type |
SRA |
| |
|
| Source name |
RNA-seq of planktonic culture of Pseudomonas aeruginosa PA01 treated with 0.2% arabinose from 45 min after inoculation (OD of 0.05) to OD 1.5
|
| Organism |
Pseudomonas aeruginosa PAO1 |
| Characteristics |
cell line: pHERD20T:pleD*
strain: PA01
|
| Treatment protocol |
Expression of pHERD20T based plasmids was induced with 0.2 % arabinose after 45 min of growth. Cells were harvested at indicated OD.
|
| Growth protocol |
Bacterial cultures were grown in liquid LB supplemented with 400 µg/ml carbenicillin at 37 °C and 180 rpm. Cultures were inoculated with OD600 of 0.05.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Total RNA was extracted by mixing bacterial cells 1:1 with RNAprotect Bacteria Reagent (Qiagen) and by using the RNeasy® Mini Kit (Qiagen) in combination with QIAshredderTM (Qiagen) according to the manufacturer’s instructions. Genomic DNA was removed by DNase treatment (DNA-free™ Kit DNase Treatment & Removal, ambion). Tag-seq was used for library preparation including rRNA removal by treatment with RiboZero (Illumina).
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina HiSeq 2500 |
| |
|
| Description |
processed data file: rpg_table2.csv
|
| Data processing |
RiboSeq
clipping using cutadapt (AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC)
Reference genome: NC_002516.2 (Pseudomonas aeruginosa PA01)
bowtie -m 1
RNASeq
Reference genome: NC_002516.2 (Pseudomonas aeruginosa PA01)
bowtie --trim3 1 -m 1
RNASeq_repetition
cutadapt --nextseq-trim=20 -g 'TTTTT;min_overlap=1' -G 'GGGGGGG;min_overlap=3' -m 36
Reference genome: NC_002516.2 (Pseudomonas aeruginosa PA01)
bowtie2 --very-sensitive-local -I 100 -X 1200
Supplementary_files_format_and_content: raw count data
|
| |
|
| Submission date |
Feb 02, 2022 |
| Last update date |
Sep 03, 2024 |
| Contact name |
Matthias Preusse |
| Organization name |
Helmholtz Centre for Infection Research
|
| Street address |
Inhoffenstr. 7
|
| City |
Braunschweig |
| ZIP/Postal code |
38124 |
| Country |
Germany |
| |
|
| Platform ID |
GPL18782 |
| Series (1) |
| GSE183394 |
Pseudomonas aeruginosa post-translational responses to elevated c-di-GMP levels |
|
| Relations |
| BioSample |
SAMN25597901 |
| SRA |
SRX14023575 |
