|
| Status |
Public on Apr 01, 2023 |
| Title |
pDC with nociceptors capsaicin biol rep 1 |
| Sample type |
SRA |
| |
|
| Source name |
plasmacytoid dendritic cell
|
| Organism |
Mus musculus |
| Characteristics |
cell type: plasmacytoid dendritic cell
genotype: WT
treatment: coculture with nociceptors + 1uM capsaicin
|
| Treatment protocol |
BM-DCs were cultured either alone or in the presence of nociceptors overnight and treated with imiquimod or capsaicin as indicated
|
| Growth protocol |
BM-DCs were differentiated in RPMI1640 medium with 10% FCS, penicillin-streptomycin, beta-mercaptoethanol, glutamine, and 100ng/ml Flt3L and harvested on day 9.
|
| Extracted molecule |
polyA RNA |
| Extraction protocol |
A thousand cells of each population were sorted directly into 5ul of lysis buffer (TCL Buffer (Qiagen) with 1% b‑mercaptoethanol)
Total RNA was captured and purified on RNAClean XP beads (Beckman Coulter). Polyadenylated mRNA was then selected using an anchored oligo(dT) primer (5′‑AAGCAGTGGTATCAACGCAGAGTACT30VN‑3′) and converted to cDNA via reverse transcription.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Description |
DC+DRG_caps1_pDC_1
|
| Data processing |
Reads were aligned to the mouse genome (GENCODE GRCm38/mm10 primary assembly and gene annotations vM16; https://www.gencodegenes.org/mouse_releases/16.html) with STAR 2.5.4a (https://github.com/alexdobin/STAR/releases).
The ribosomal RNA gene annotations were removed from GTF (General Transfer Format) file.
The gene-level quantification was calculated by featureCounts (http://subread.sourceforge.net/).
Assembly: mm10
Supplementary files format and content: csv text file includes raw count table containing all samples
|
| |
|
| Submission date |
Nov 07, 2022 |
| Last update date |
Apr 01, 2023 |
| Contact name |
Ulrich von Andrian |
| E-mail(s) |
[email protected]
|
| Organization name |
Harvard Medical School
|
| Department |
Immunology
|
| Street address |
77 Ave Louis Pasteur
|
| City |
Boston |
| State/province |
MA |
| ZIP/Postal code |
02115 |
| Country |
USA |
| |
|
| Platform ID |
GPL19057 |
| Series (2) |
| GSE217500 |
Effect of nociceptors on dendritic cells |
| GSE217503 |
Multi-modal control of dendritic cell functions by nociceptors |
|
| Relations |
| BioSample |
SAMN31648179 |
| SRA |
SRX18200794 |
