 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Nov 01, 2023 |
| Title |
∆SI3* biol rep3 OD0.49 |
| Sample type |
SRA |
| |
|
| Source name |
bacterial cell
|
| Organism |
Escherichia coli |
| Characteristics |
cell type: bacterial cell
strain: RL3000
spike-in control: Bacillus subtilis RL3116
genotype: F- lambda- ilvG468+ rfb-50 rph+ ybhJ(L54->I) yebN(G25xxx->D) ycfK::97bp deltaInsB-5 deltaInsA-5 deltaInsAB-5 rpoC(A941T, deltaSI3)::3XFLAG, B. subtilis 168 trpC2 rpoC::3XFLAG
treatment: Mixing with spike-in control cells
fraction: Nascent RNA
|
| Growth protocol |
A single colony of E. coli NET-seq strains was inoculated into MOPS rich defined medium with 0.2% (w/v) glucose (RDM) and 50 µg/mL kanamycin for overnight growth at 37 °C. 2.5 mL of the overnight culture was inoculated into 0.5 L RDM with 50 µg/mL kanamycin (freshly prepared and sterilized with 0.22 µM filter) in Erlenmeyer flasks and culture with 200 revolution per minute orbital shaking at 37 °C until cell density reached early log-phase (OD~0.4, record OD value at harvesting). At 37 °C, quickly filter cells through a 0.22 µM cellulose filter unit and transform all cell pellets into liquid nitrogen with a spatula. Frozen cells were stored at –80 °C before homogenizing. Biological triplicate samples were collected for each NET-seq strain. As for B. subtilis spike-in cells (RL3116), a single colony was inoculated into 5 mL LB with 7.5 µg/mL kanamycin for overnight growth at 37 °C. 2.5 mL of the overnight culture was inoculated into 0.5 L LB with 7.5 µg/mL kanamycin at 37 °C until cell density reached early log-phase (OD~0.4, record OD value at harvesting). Spin down cells with centrifugation at 4,000 Xg for 10 min for the cell pellet. Resuspend cells with 10 mL ice cold sterile PBS (with 20% (v/v) glycerol and 0.5 mL 1X protease inhibitor cocktail) and flash frozen in liquid nitrogen.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Frozen cells were pulverized on a Retsch MM400 Mixer Mill (canisters pre-cooled in liquid nitrogen) 6 times at 15 Hz for 3 min in the presence of 400 µL frozen lysis buffer (20 mM Tris-HCl, pH=8.0, 0.4% Triton-X 100, 0.1% NP-40, 100 mM NH4Cl, 10 mM MnCl2, 250 Unit RNaseIn (Promega), 1X protease inhibitor cocktail, 0.4 mg/mL puromycin). Spike-in cells were thawed on ice and added proportional to the E. coli cell amount (500 µL*OD E.coli) to homogenize with E. coli cells. The lysate was resuspended on ice with extra 5 mL of lysis buffer by gentle pipetting. RQ1 DNase I (110 Unit total, Promega) was added and incubated for 15 min on ice. The reaction was quenched with EDTA (25 mM final), which releases ribosomes from the transcript. The lysate was clarified at 4 °C by centrifugation at 25,000 xg for 10 min and incubated with 0.5 mL anti-FLAG M2 affinity resin (Sigma-Aldrich) for 3 hours at 4 °C. The resin was washed with 10 mL Wash Buffer (20 mM Tris-HCl, pH=8.0, 0.4% Triton-X 100, 0.1% NP-40, 300 mM KCl, 1 mM EDTA) 4 times at 4 °C and the RNAP was eluted with 600 µL Elution Buffer (20 mM Tris-HCl, pH=8.0, 0.4% Triton-X 100, 0.1% NP-40, 2 mg/mL FLAG peptide (Sigma-Aldrich)). Nascent RNA was extracted from the eluate with miRNeasy Mini Kit (Qiagen) following manufacturer’s instructions. The nascent RNA sample was further purified by EtOH precipitation, dissolved in DEPC-treated water and store at –80 °C.
The adaptor oligo(/5Phos/CTGTAGGCACCATCAAT/3ddC/, 6 µM) was 5' adenylated by incubating with 80 µM ATP, 6 µM Mth RNA ligase (NEB), 25% (v/v) PEG 8000 in 1X NEB Buffer 1 at 65 °C for 4 hours, then 85 °C for 5 min. Nascent RNA (16.7 ng/µL, normally 1.5 µg for each sample) was ligated to the adaptor by incubating with 1X T4 RNA ligase buffer (NEB), 25% PEG 8000, 6.7 Unit/µL T4 RNA ligase 2, truncated (NEB), 2 µM adaptor, 1.3 Unit/µL RNaseIn at 37 °C for 3 hours. The ligation was stopped by adding 16 mM EDTA. The adaptor-ligated RNA was alkaline fragmented by incubating with 6 mM Na2CO3, 44 mM NaHCO3, 1 mM EDTA at 95 °C for 35 min (time may vary depending on the freshness of the alkaline solution) and the RNA was precipitated by isopropanol precipitation with NaOAc (pH=5.5) and GlycoBlue coprecipitant (Thermo Fisher). The fragmented, adaptor-ligated RNA was run on a 15% TBE urea polyacrylamide gel (Novex, Thermo Fisher) and RNA species ranging from 50 to 100 nt was excised and gel extracted. The RNA was reversely transcribed into cDNA by mixing with 1X First Strand Buffer (Thermo Fisher), 0.5 mM dNTPs, 0.3 µM RT adaptor (/5Phos/AGATCGGAAGAGCACACGTCTGAAC/iSp18/CACTCA/iSp18/CCTACACGACGCTCTTCCGATCTTCCGACGATCATTGATGGTGCCTACAG), 0.6 Unit/µL SuperaseIn, 5 mM DTT, 10 Unit/µL Superscript III (Thermo Fisher) and incubating at 50 °C for 60 min. The RNA template in the cDNA was eliminated by adding 0.1 M NaOH and incubating at 95 °C for 20 min followed by adding 0.1 M HCl. The cDNA was run on a 10% TBE urea polyacrylamide gel (Novex, Thermo Fisher) and DNA species ranging from 100 to 200 nt was excised and gel extracted. The cDNA library was circularized by incubating with 1X Reaction Buffer (Lucigen), 50 µM ATP, 2.5 µM MnCl2, 5 Unit/µL CircLigase (Lucigen) at 60 °C for 1 hour followed by 80 °C for 10 min. The cDNA libraries were amplified with Q5 DNA polymerase (NEB) PCR system using dual indexed primers for NovaSeq 6000 (Illumina) sequencing platform using 150-nt paired-end sequencing.
|
| |
|
| Library strategy |
OTHER |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina NovaSeq 6000 |
| |
|
| Data processing |
NET-seq data analysis was performed using open-sourced packages in Python and custom scripts written in R 4.1.0. Adaptor sequence in raw NET-seq reads was removed with Cutadapt and aligned to E. coli MG1655 reference genome (NCBI Reference Sequence: NC_000913.3) with Bowtie. Unwanted reads in ribosomal RNA regions and t-RNA regions were removed with SAMtools and converted to BED format with BEDTools. Full length NET-seq reads were then trimmed to 15 nt from 3' ends. The total read numbers and 3' end read numbers in genome positions were quantified with BEDTools. To scale reads among strains and replicates, 3' end read numbers (R(raw)) were normalized according to the E. coli cell genomic DNA amount in cell harvested (M(E. coli)), the B. subtilis spike-in cell number (N(spike-in)) and the reads (R(spike-in)) specifically aligned to B. subtilis genome (NCBI Reference Sequence: NC_000964.3): scaled 3' end read R(scaled) = 2.5 * 10^8 * R(raw) * N(spike-in) / ( M(E. coli) * R(spike-in)). M(E. coli) was calculated with pre-determined equation for the two NET-seq strains: for WT NET-seq strain, M(E. coli) = (7.24 * OD + 3.98) * 500; for ∆SI3* NET-seq strain, M(E. coli) = (9.83 * OD + 9.34) * 500.
For pause calling, we used a multi-round sliding window strategy: for each position in a transcription unit, if its 3' end read number is larger than the mean + 4*standard deviation of the non-zero read pool containing this position, 100 bp upstream and 99 bp downstream, then it is classified as a pause signal. The pause reads defined in the first round is removed from the pool and the remaining sites were subjected to pause calling in the next round. Four rounds of pause calling in total were conducted and common pause positions from 3 biological replicates were used as the final pause positions. Detected pause signals located in several tRNA and sRNA genes were filtered due to their high probability of contamination during NET-seq library preparation. In addition, pause signals matching mature RNA 3' ends were also removed based on the published E. coli SEnd-seq results.
Assembly: E. coli: NC_000913.3, B. sub: NC_000964.3
Supplementary files format and content: Tab-delimited text files recording normalized nascent RNA 3' end reads and total reads (read trimmed to 15 nt) covering each genomic position.
Library strategy: NET-seq
|
| |
|
| Submission date |
Apr 27, 2023 |
| Last update date |
Nov 01, 2023 |
| Contact name |
Robert Landick |
| E-mail(s) |
[email protected]
|
| Organization name |
University of Wisconsin–Madison
|
| Department |
Department of Biochemistry
|
| Lab |
Landick
|
| Street address |
1550 Linden drive
|
| City |
Madison |
| State/province |
Wisconsin |
| ZIP/Postal code |
53705 |
| Country |
USA |
| |
|
| Platform ID |
GPL25368 |
| Series (1) |
| GSE230757 |
Nascent elongating transcript sequencing (NET-seq) with SI3 domain-deleted Escherichia coli reveals different pause profiles from wildtype |
|
| Relations |
| BioSample |
SAMN34405142 |
| SRA |
SRX20118777 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM7233771_deltaSI3_rep3.txt.gz |
47.2 Mb |
(ftp)(http) |
TXT |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
