 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Nov 17, 2011 |
| Title |
trm44del tan1del (JMW119) 6 hr Replicate 2 |
| Sample type |
SRA |
| |
|
| Source name |
trm44 tan1 deletion strain
|
| Organism |
Saccharomyces cerevisiae |
| Characteristics |
strain: JMW119
hours at 37 degrees: 6
replicate number: 2
|
| Growth protocol |
Strains were grown in YPD medium at 28 degrees until OD600 ~1.5 and then shifted to 37 degrees for the indicated amounts of time.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
At the indicated time points, 2 mL of culture was harvested, pelleted, rinsed with 1 mL of cold sterile water, pelleted, and frozen on dry ice. RNA was purified from cells using hot phenol. A pre-adenylated oligo (miRNA Linker 3, IDT; 5’-rAppTTTAACCGCGAATTCCAG/3ddC/) was ligated to the 3’ ends of 1.5 micrograms of total RNA using the truncated form of T4 RNA Ligase 2 (New England Biolabs). Ligation reactions were incubated at room temperature for 2 hr followed by a phenol/chloroform extraction and ethanol precipitation. Reverse transcription was then performed using Superscript III (Invitrogen) as per the manufacturer’s instructions and 5 pmol of primer complementary to the 3’ linker sequence (5’-GACTAGCTGGAATTCGCGGTTAAA). cDNAs were amplified by PCR using AmpliTaq DNA Polymerase (Applied Biosystems). To sequence the 3’ ends of the endogenous tRNASer(CGA) and tRNASer(UGA) transcripts (due to their high similarity, this sequencing approach can not distinguish between them), the following forward (5’- CAAGCAGAAGACGGCATACGAGGxxxxxxxGGCTCTGCCCGCGCTGG, where xxxxxxx is a unique 7-nucleotide barcode for each RNA prep so that multiple samples can be run together in a single lane of an Illumina flow cell) and reverse (5’-AATGATACGGCGACCACCGAGGACTAGCTGGAATTCGCGGTTAAA) primers were used. These forward and reverse primers were also used to amplify the U6:A67 tRNASer(CGA) variant from strain JMW561 – however, only reads that contained the A67 mutation were included in the downstream analysis. To sequence the 3’ ends of the G51:C63, C6:G67, G2:C71 tRNASer(CGA) variant (strain JMW1251) or the G51:C63 tRNASer(CGA) variant (strain JMW316), the following forward (5’- CAAGCAGAAGACGGCATACGAGGxxxxxxxGCGGGTTCAAATCCCGC, where xxxxxxx is a unique 7-nucleotide barcode) and reverse (5’-AATGATACGGCGACCACCGAGGACTAGCTGGAATTCGCGGTTAAA) primers were used to avoid amplification of the endogenous tRNASer(UGA) loci. PCR reactions were incubated at 94º for 2 min, followed by 21 cycles of 94º for 15 sec, 58º for 30 sec, and 72º for 30 sec. All PCR reactions were then combined in one tube and extracted with phenol/chloroform and ethanol precipitated. Using a 2% low melting point agarose gel, the PCR products (~110 to 120 bp) were purified and then cleaned up using a phenol extraction, followed by a phenol/chloroform extraction, followed by a chloroform extraction. The purified DNA was resuspended in water and subjected to deep sequencing using the Illumina HiSeq 2000 Sequencing System and the following sequencing primer (5’-CCGAGGACTAGCTGGAATTCGCGGTTAAA). 58 nucleotide reads from the 3’ ends of each transcript were obtained.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
RACE |
| Instrument model |
Illumina HiSeq 2000 |
| |
|
| Data processing |
The resulting sequencing files were processed by collapsing identical reads and reverse complementing the sequences (as this sequencing strategy actually sequences the reverse complement of a given transcript).
|
| |
|
| Submission date |
Nov 16, 2011 |
| Last update date |
May 15, 2019 |
| Contact name |
Jeremy E Wilusz |
| E-mail(s) |
[email protected]
|
| Phone |
617-253-6457
|
| Fax |
617-253-3867
|
| Organization name |
Massachusetts Institute of Technology
|
| Department |
Koch Institute for Integrative Cancer Research
|
| Street address |
77 Massachusetts Ave, Bldg 76-461
|
| City |
Cambridge |
| State/province |
MA |
| ZIP/Postal code |
02139 |
| Country |
USA |
| |
|
| Platform ID |
GPL13821 |
| Series (1) |
| GSE33756 |
tRNAs marked with CCACCA are targeted for degradation |
|
| Relations |
| SRA |
SRX105811 |
| BioSample |
SAMN00754349 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM835031_JMW119_6hr_Rep2.txt.gz |
75.0 Kb |
(ftp)(http) |
TXT |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
