|
| Status |
Public on Aug 25, 2012 |
| Title |
ESC scr shRNA |
| Sample type |
RNA |
| |
|
| Source name |
D3 ESC treated with lentivirus expressing scr shRNA
|
| Organism |
Mus musculus |
| Characteristics |
knockdown: scramble
cell line: D3
cell type: D3 undifferentiated ES cells
|
| Treatment protocol |
For treatment with the Msi2 shRNA #1 or scr shRNA, D3 ESC were seeded at a density of 100,000 cells per well in a 6-well plate. One day later, cells were infected with lentiviruses that express either the scrambled shRNA or shRNA #1 targeting Msi2. The protocol for infection of D3 ESC with lentiviruses has been described previously (Cox,J.L., 2011, PMID: 21750191). D3 ESC were infected with lentiviruses for 24 hours followed by selection with puromycin for 24 hours. Cells were subcultured 48 hours after puromycin selection at a low density (4,500 cells per cm2). Cells were maintained for 4 days in normal ES cell media followed by RNA isolation.
|
| Growth protocol |
Stock cultures of D3 mouse ESC (ATCC number CRL-1934, obtained from T. Doetschman) were cultured as described previously (Kopp,J.L., 2008, PMID: 18238855). Culture medium was supplemented with 5 ng/ml leukemia inhibitory factor. Production of lentiviruses in 293T cells, including the lentivirus that expresses the scrambled shRNA sequence used in this study, has been described previously (Cox,J.L., 2011, PMID: 21750191). Lentiviral vectors for expression of shRNA sequences that target mouse Msi2 were obtained from Open Biosystems (RMM4534-NM_054043, Huntsville, AL). Msi2 shRNA lentiviral construct #1 used in this study corresponds to TRCN0000071973 with the mature sense sequence: CCCAGCTTAATATCTAGTTAA (Open Biosystems).
|
| Extracted molecule |
total RNA |
| Extraction protocol |
RNA isolation has been described previously (Kopp,J.L., 2008, PMID: 18238855).
|
| Label |
biotin
|
| Label protocol |
Sense-strand cDNA was generated from 300ng total RNA using the Ambion WT Expression kit for Affymetrix Whole Transcript Expression Arrays. This cDNA was fragmented and labeled using the GeneChip® WT Terminal Labeling and Hybridization.
|
| |
|
| Hybridization protocol |
Hybridization for 16 hours at 45C using the GeneChip® WT Terminal Labeling and Hybridization on Affymetrix GeneChip Mouse Gene 1.0 ST. Washing and staining were performed with the Affymetrix Fluidics Station 450.
|
| Scan protocol |
The gene chips were scanned using the Affymetrix GeneChip Scanner 3000 7G by the University of Nebraska Medical Center DNA Microarray Core Facility.
|
| Description |
Gene expression data from D3 undifferentiated ES cells
|
| Data processing |
Data was analyzed with Affymetrix Expression Console software (Affymetrix, Santa Clara, CA) using Robust Multichip Analysis (RMA) for normalization.
|
| |
|
| Submission date |
Nov 22, 2011 |
| Last update date |
Aug 25, 2012 |
| Contact name |
Angie Rizzinio |
| E-mail(s) |
[email protected]
|
| Organization name |
University of Nebraska Medical Center
|
| Department |
Eppley Institute for Research in Cancer and Allied Diseases
|
| Street address |
986805 Nebraska Medical Center
|
| City |
Omaha |
| State/province |
NE |
| ZIP/Postal code |
68198-6805 |
| Country |
USA |
| |
|
| Platform ID |
GPL6246 |
| Series (1) |
| GSE33882 |
Musashi2 is required for the self-renewal and pluripotency of embryonic stem cells |
|
