 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Sep 30, 2012 |
| Title |
brain RNAseq control-oligo rep3.1 |
| Sample type |
SRA |
| |
|
| Source name |
Striatum
|
| Organism |
Mus musculus |
| Characteristics |
tissue: brain striatum
genetic background: C57BL/6
age: 8-10 weeks
treatment: control anti-sense oligo
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Cells from whole brain of ten mice were pooled; cell suspension was distributed in 10 cm cell culture dishes and irradiated three times at 400 mJ/cm2 on ice with short breaks between each exposure. Irradiated brain cells were precipitated by brief centrifugation at 4oC, resuspended in PBS and distributed in ten 1.6 mL tubes, each containing cells corresponding to one mouse brain. Cells were disrupted on ice using PBS containing 0.1% SDS, 0.5% deoxycholate (Na), 0.5% NP-40, DNase treated and cleared from cell debris. Cell extracts were then incubated with protein G paramagnetic beads (Invitrogen) coupled to a custom-made mouse monoclonal anti-TDP-43 antibody (Ling, 2010) (40mg of antibody per 400 mL of beads per sample). After 4hrs, beads were washed and associated RNAs were treated with three different concentrations (100U, 0.2U and 0.02U per sample) of micrococcal nuclease (MNase, Roche), while attached on the beads. Samples were then treated with alkaline phosphatase (NEB) and an RNA-linker (5¢P-UCGUAUGCCGUCUUCUGCUUG-Pmm, Thermo Scientific) was attached to the 3¢ end of RNAs. At this step we saved 40ul of each sample for immunoblot analysis before radiolabelling. The remaining samples were then labeled with P32-g-ATP using T4 polynucleotide kinase (NEB). Unlabelled and radiolabeled RNA-protein complexes were then released from the beads by incubating at 70oC in NuPAGE LDS sample buffer without reducing agent (Invitrogen). Samples were then migrated on 10% Bis-Tris NuPAGE gels using MES buffer (Invitrogen) and transferred to nitrocellulose membranes (0.45 mm pore size, Invitrogen). The membrane with unlabelled samples was subjected to immunobloting using a primary antibody rabbit anti-TDP-43 (Aviva system biology; Cat #ARP38942_T100; 1:2,000) (see below for the immunoblot protocol). The membrane with the radiolabelled samples was rinsed with PBS, put in a clean plastic wrap and exposed to an autoradiography film. Using the autoradiogram as a guide, membrane pieces containing complexes with higher molecular weight than the expected protein size were excised. Isolated membrane pieces were then incubated with 4mg/mL Proteinase K (Takara Bio Inc.) at 37oC for 20 min with shaking at 1200 rpm. The reaction was stopped with the addition of 7 M Urea and incubation at 37oC for 20 min with shaking at 1000 rpm. The released RNA were then extracted with phenol:chloroform. To precipitate the RNA, the aqueous phase was transferred in a separate tube where sodium acetate, linear acrylamide, ethanol and isopropanol were added and the samples were incubated at -20oC overnight. The next day, samples were centrifuged for 10 mins at maximum speed in a microcentrifuge at 4oC. RNA pellets were washed twice with 75% ethanol and dried at room temperature. RNAs were resuspended in an RNA ligation buffer and an RNA-linker (Bi-AAUGAUACGGCGACCACCGA, Thermo Scientific) was attached to their 5¢ end. Samples were treated once more with DNase I and precipitated with Phenol Chloroform as described above. RNAs were then reverse transcribed using SuperScript III (Invitrogen) and amplified by PCR using high fidelity Phusion polymerase (NEB) with the following primers: CAAGCAGAAGACGGCATACGA (P3) and AATGATACGACCACCGA (P5). Amplified libraries were then migrated in a 12% acrylamide gel and 75-200bp DNA fragments were excised and frozen at -20oC overnight. Acrylamide pieces were crushed into smaller pieces and DNA fragments were eluted by incubating overnight at 4oC in 50mM NaCl, 10mM TrisHCl, pH=8.0. Supernatants containing the DNA libraries were incubated with 3M sodium acetate and 100% ethanol with glycogen to facilitate DNA precipitation overnight at -80oC. DNA fragments were precipitated and pellets were resuspended in water and filtered through Spin X Centrifuge tube filter (Costar) to remove acrylamide contaminants. DNA libraries were precipitated and then resuspended in 12-20mL of DEPC-treated water. Libraries were quantified by the Qubit Quantitation Platform (Invitrogen) before loading on an Illumina Genome Analyzer 2 (GA2) flow-cell in a concentration of 8 pM per lane. Sequencing was carried out on the Illumina GA2 according to the manufacturer’s instructions for 36 cycles using the “P5” primer.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina Genome Analyzer II |
| |
|
| Description |
strand-specific RNAseq
|
| Data processing |
Sequenced reads were trimmed for adaptor sequence, and masked for low-complexity or low-quality sequence, then mapped to mm9 or hg18 whole genome using bowtie v0.12.2 with parameters -q -p 4 -e 100 -y -a -m 10 --best --strata
Genome_build: mm9
Supplementary_files_format_and_content: BED format of all reads
|
| |
|
| Submission date |
Sep 06, 2012 |
| Last update date |
May 15, 2019 |
| Contact name |
Gene Yeo |
| E-mail(s) |
[email protected]
|
| Organization name |
UCSD
|
| Street address |
2880 Torrey Pines Scenic Dr. Room 3805/Yeo Lab
|
| City |
La Jolla |
| State/province |
CA |
| ZIP/Postal code |
92037 |
| Country |
USA |
| |
|
| Platform ID |
GPL9250 |
| Series (2) |
| GSE40652 |
Divergent roles of ALS-linked proteins FUS/TLS and TDP-43 intersect in processing long pre-mRNAs (RNA-Seq) |
| GSE40653 |
Divergent roles of ALS-linked proteins FUS/TLS and TDP-43 intersect in processing long pre-mRNAs |
|
| Relations |
| SRA |
SRX183761 |
| BioSample |
SAMN01162346 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM998881_MP27_1.BED.gz |
128.5 Mb |
(ftp)(http) |
BED |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
