GEO Profile Links for Gene (Select 216134) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 1000

<< First< Prev

Page of 50

Next >Last >>

Select item 569495361.

Pdxk - Vancomycin effect on the kidney: dose response

Annotation:: Pdxk, pyridoxal (pyridoxine, vitamin B6) kinase

Organism:: Mus musculus

Reporter:: GPL1261, 1427930_at (ID_REF), GDS3435, 216134 (Gene ID), BG063905

DataSet type:: Expression profiling by array, count, 48 samples

ID:: 56949536

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 66788262.

Pdxk - Preimplantation embryo development (MOE430A)

Annotation:: Pdxk, pyridoxal (pyridoxine, vitamin B6) kinase

Organism:: Mus musculus

Reporter:: GPL339, 1427931_s_at (ID_REF), GDS813, 216134 (Gene ID), BG063905

DataSet type:: Expression profiling by array, count, 20 samples

ID:: 6678826

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 742055263.

Pdxk - Preimplantation embryonic development (MOE430A)

Annotation:: Pdxk, pyridoxal (pyridoxine, vitamin B6) kinase

Organism:: Mus musculus

Reporter:: GPL339, 1427931_s_at (ID_REF), GDS3958, 216134 (Gene ID), BG063905

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 74205526

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 155322244.

Pdxk - Forebrain neuronal subtypes

Annotation:: Pdxk, pyridoxal (pyridoxine, vitamin B6) kinase

Organism:: Mus musculus

Reporter:: GPL339, 1427929_a_at (ID_REF), GDS1522, 216134 (Gene ID), BG063905

DataSet type:: Expression profiling by array, count, 42 samples

ID:: 15532224

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1270756745.

Pdxk - 17β-estradiol effect on uterus of uterine epithelial ERα conditional knockout model: time course

Annotation:: Pdxk, pyridoxal (pyridoxine, vitamin B6) kinase

Organism:: Mus musculus

Reporter:: GPL4134, 42474 (ID_REF), GDS5461, AK009645, A_52_P359502 (SPOT ID)

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 127075674

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 470518376.

Pdxk - Matrix metalloproteinase mutant airway epithelial cells response to Pseudomonas aeruginosa infection: time course

Annotation:: Pdxk, pyridoxal (pyridoxine, vitamin B6) kinase

Organism:: Mus musculus

Reporter:: GPL1261, 1427931_s_at (ID_REF), GDS3040, 216134 (Gene ID), BG063905

DataSet type:: Expression profiling by array, transformed count, 25 samples

ID:: 47051837

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 370128367.

Pdxk - Asthma model: lungs

Annotation:: Pdxk, pyridoxal (pyridoxine, vitamin B6) kinase

Organism:: Mus musculus

Reporter:: GPL1261, 1427930_at (ID_REF), GDS2647, 216134 (Gene ID), BG063905

DataSet type:: Expression profiling by array, count, 16 samples

ID:: 37012836

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1303874748.

Pdxk - Estradiol effect on uterus of EAAE estrogen receptor α DNA-binding-deficient model

Annotation:: Pdxk, pyridoxal (pyridoxine, vitamin B6) kinase

Organism:: Mus musculus

Reporter:: GPL4134, 42474 (ID_REF), GDS5664, AK009645, A_52_P359502 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 130387474

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 640590789.

Pdxk - SIRT1 deficiency effect on the liver

Annotation:: Pdxk, pyridoxal (pyridoxine, vitamin B6) kinase

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P359502 (ID_REF), GDS3666, NM_172134, A_52_P359502 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 64059078

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 447531610.

Pdxk - Zygotic gene activation

Annotation:: Pdxk, pyridoxal (pyridoxine, vitamin B6) kinase (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL870, 6216 (ID_REF), GDS579, AK009645, AK039194, AK080846, BC065993, H3020F01-5_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 36 samples

ID:: 4475316

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 666366211.

Pdxk - Preimplantation embryo development (MG-U74A)

Annotation:: Pdxk, pyridoxal (pyridoxine, vitamin B6) kinase

Organism:: Mus musculus

Reporter:: GPL81, 96519_at (ID_REF), GDS812, 216134 (Gene ID)

DataSet type:: Expression profiling by array, count, 17 samples

ID:: 6663662

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 748774612.

Pdxk - MPSS transcriptome analysis project

Annotation:: Pdxk, Pyridoxal (pyridoxine, vitamin B6) kinase

Organism:: Mus musculus

Reporter:: GPL1010, GATCCCCTCAAAGCTCAGGC (ID_REF), GDS868, BG083682

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7487746

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 5362853713.

Pdxk - Calcium-signaling effects on blastocyts

Annotation:: Pdxk, pyridoxal (pyridoxine, vitamin B6) kinase

Organism:: Mus musculus

Reporter:: GPL1261, 1427931_s_at (ID_REF), GDS3293, 216134 (Gene ID), BG063905

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 53628537

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4705183614.

Pdxk - Matrix metalloproteinase mutant airway epithelial cells response to Pseudomonas aeruginosa infection: time course

Annotation:: Pdxk, pyridoxal (pyridoxine, vitamin B6) kinase

Organism:: Mus musculus

Reporter:: GPL1261, 1427930_at (ID_REF), GDS3040, 216134 (Gene ID), BG063905

DataSet type:: Expression profiling by array, transformed count, 25 samples

ID:: 47051836

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8901313615.

Pdxk - Nitric oxide generator DETA-NONOate effect on in vitro neuronal injury model: time course

Annotation:: Pdxk, pyridoxal (pyridoxine, vitamin B6) kinase

Organism:: Mus musculus

Reporter:: GPL1261, 1427930_at (ID_REF), GDS4408, 216134 (Gene ID), BG063905

DataSet type:: Expression profiling by array, transformed count, 14 samples

ID:: 89013136

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7283636216.

Pdxk - Spatial and temporal development of mammalian salivary glands

Annotation:: Pdxk, pyridoxal (pyridoxine, vitamin B6) kinase

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P498640 (ID_REF), GDS3922, NM_172134, A_51_P498640 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 84 samples

ID:: 72836362

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 8901313717.

Pdxk - Nitric oxide generator DETA-NONOate effect on in vitro neuronal injury model: time course

Annotation:: Pdxk, pyridoxal (pyridoxine, vitamin B6) kinase

Organism:: Mus musculus

Reporter:: GPL1261, 1427931_s_at (ID_REF), GDS4408, 216134 (Gene ID), BG063905

DataSet type:: Expression profiling by array, transformed count, 14 samples

ID:: 89013137

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12427253518.

Pdxk - Lipopolysaccharide effect on tumor progression locus 2 kinase-deficient macrophages

Annotation:: Pdxk, pyridoxal (pyridoxine, vitamin B6) kinase

Organism:: Mus musculus

Reporter:: GPL1261, 1427929_a_at (ID_REF), GDS5385, 216134 (Gene ID), BG063905

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 124272535

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11221163619.

Pdxk - Cystatin B knockout model of progressive myoclonus epilepsy: postnatal day 7 cerebellum

Annotation:: Pdxk, pyridoxal (pyridoxine, vitamin B6) kinase

Organism:: Mus musculus

Reporter:: GPL1261, 1427930_at (ID_REF), GDS5089, 216134 (Gene ID), BG063905

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 112211636

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2017533620.

Pdxk - Age effect on hematopoietic stem cells

Annotation:: Pdxk, pyridoxal (pyridoxine, vitamin B6) kinase

Organism:: Mus musculus

Reporter:: GPL1261, 1427930_at (ID_REF), GDS1803, 216134 (Gene ID), BG063905

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 20175336

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 50

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 216134) (1000)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 1000

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity