GEO Profile Links for Gene (Select 373864) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 1000

<< First< Prev

Page of 50

Next >Last >>

Select item 202005861.

Col27a1 - Age effect on hematopoietic stem cells

Annotation:: Col27a1, collagen, type XXVII, alpha 1

Organism:: Mus musculus

Reporter:: GPL1261, 1453191_at (ID_REF), GDS1803, 373864 (Gene ID), BB044654

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 20200586

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 273926312.

Col27a1 - Runt-related transcription factor 2 null mutation effect on the embryonal bone (MG-U74B)

Annotation:: Col27a1, collagen, type XXVII, alpha 1

Organism:: Mus musculus

Reporter:: GPL82, 116181_at (ID_REF), GDS2185, 373864 (Gene ID), AI020226

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 27392631

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 273917553.

Col27a1 - Runt-related transcription factor 2 null mutation effect on the embryonal bone (MG-U74B)

Annotation:: Col27a1, collagen, type XXVII, alpha 1

Organism:: Mus musculus

Reporter:: GPL82, 115210_at (ID_REF), GDS2185, 373864 (Gene ID), AA985762

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 27391755

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 75196904.

Col27a1 - MPSS transcriptome analysis project

Annotation:: Col27a1, collagen, type XXVII, alpha 1

Organism:: Mus musculus

Reporter:: GPL1010, GATCCCCATCTGTCTGCCCA (ID_REF), GDS868, AK003879

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7519690

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 127279745.

Col27a1 - Forelimb and hindlimb embryonic autopod comparison (MG-430B)

Annotation:: Col27a1, collagen, type XXVII, alpha 1

Organism:: Mus musculus

Reporter:: GPL340, 1453191_at (ID_REF), GDS1343, 373864 (Gene ID), BB044654

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 12727974

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 826592866.

Col27a1 - Mixed lineage leukemia fusion protein induction of acute leukemia: bone marrow cells

Annotation:: Col27a1, collagen, type XXVII, alpha 1

Organism:: Mus musculus

Reporter:: GPL1261, 1453191_at (ID_REF), GDS4169, 373864 (Gene ID), BB044654

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 82659286

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 75089947.

Col27a1 - MPSS transcriptome analysis project

Annotation:: Col27a1, collagen, type XXVII, alpha 1

Organism:: Mus musculus

Reporter:: GPL1010, GATCCTGGTGCAGGTCCTAG (ID_REF), GDS868, BC038041

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7508994

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 172093558.

Col27a1 - RPE65 null mutant model of Leber's congenital amaurosis

Annotation:: Col27a1, collagen, type XXVII, alpha 1

Organism:: Mus musculus

Reporter:: GPL1261, 1429549_at (ID_REF), GDS1647, 373864 (Gene ID), BB044654

DataSet type:: Expression profiling by array, transformed count, 18 samples

ID:: 17209355

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1253216869.

Col27a1 - Age effect on respiratory epithelium: distal trachea and carina region

Annotation:: Col27a1, collagen, type XXVII, alpha 1

Organism:: Mus musculus

Reporter:: GPL1261, 1453191_at (ID_REF), GDS5412, 373864 (Gene ID), BB044654

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 125321686

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 3750537410.

Col27a1 - Embryonic R1 stem cell differentiation in vitro (MG-430B)

Annotation:: Col27a1, collagen, type XXVII, alpha 1

Organism:: Mus musculus

Reporter:: GPL340, 1453191_at (ID_REF), GDS2667, 373864 (Gene ID), BB044654

DataSet type:: Expression profiling by array, count, 33 samples

ID:: 37505374

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 8263565511.

Col27a1 - Mixed lineage leukemia fusion protein induction of acute leukemia: bone marrow cells

Annotation:: Col27a1, collagen, type XXVII, alpha 1

Organism:: Mus musculus

Reporter:: GPL1261, 1429549_at (ID_REF), GDS4169, 373864 (Gene ID), BB044654

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 82635655

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 3755207412.

Col27a1 - Embryonic J1 stem cell differentiation in vitro (MG-430B)

Annotation:: Col27a1, collagen, type XXVII, alpha 1

Organism:: Mus musculus

Reporter:: GPL340, 1453191_at (ID_REF), GDS2669, 373864 (Gene ID), BB044654

DataSet type:: Expression profiling by array, count, 33 samples

ID:: 37552074

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 5729998613.

Col27a1 - Murine model of primary mitochondrial dysfunction

Annotation:: Col27a1, collagen, type XXVII, alpha 1

Organism:: Mus musculus

Reporter:: GPL1261, 1453191_at (ID_REF), GDS3454, 373864 (Gene ID), BB044654

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 57299986

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 867810614.

Col27a1 - Bile ductular differentiation of embryonic hepatoblasts: time course

Annotation:: Col27a1, Collagen, type XXVII, alpha 1

Organism:: Mus musculus

Reporter:: GPL1205, 4415 (ID_REF), GDS970, AA198345

DataSet type:: Expression profiling by array, log ratio, 24 samples

ID:: 8678106

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 868694215.

Col27a1 - Bile ductular differentiation of embryonic hepatoblasts: time course

Annotation:: Col27a1, Collagen, type XXVII, alpha 1

Organism:: Mus musculus

Reporter:: GPL1205, 13886 (ID_REF), GDS970, AI449266

DataSet type:: Expression profiling by array, log ratio, 24 samples

ID:: 8686942

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2998247416.

Col27a1 - Akt1 serine-threonine protein kinase activation effect on the heart (MG-430B)

Annotation:: Col27a1, collagen, type XXVII, alpha 1

Organism:: Mus musculus

Reporter:: GPL340, 1453191_at (ID_REF), GDS2308, 373864 (Gene ID), BB044654

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 29982474

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1723298617.

Col27a1 - RPE65 null mutant model of Leber's congenital amaurosis

Annotation:: Col27a1, collagen, type XXVII, alpha 1

Organism:: Mus musculus

Reporter:: GPL1261, 1453191_at (ID_REF), GDS1647, 373864 (Gene ID), BB044654

DataSet type:: Expression profiling by array, transformed count, 18 samples

ID:: 17232986

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 3820608618.

Col27a1 - Synovial sarcoma model

Annotation:: Col27a1, collagen, type XXVII, alpha 1

Organism:: Mus musculus

Reporter:: GPL1261, 1453191_at (ID_REF), GDS2698, 373864 (Gene ID), BB044654

DataSet type:: Expression profiling by array, count, 9 samples

ID:: 38206086

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2946927419.

Col27a1 - Uniparental duplication of chromosome 7 regions effect on embryo and newborn brain (MG-430B)

Annotation:: Col27a1, collagen, type XXVII, alpha 1

Organism:: Mus musculus

Reporter:: GPL340, 1453191_at (ID_REF), GDS2281, 373864 (Gene ID), BB044654

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 29469274

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 450429620.

Col27a1 - Glomerulonephropathy

Annotation:: Col27a1, collagen, type XXVII, alpha 1

Organism:: Mus musculus

Reporter:: GPL254, 13583 (ID_REF), GDS580, AK017766

DataSet type:: Expression profiling by array, log ratio, 15 samples

ID:: 4504296

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 50

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 373864) (1000)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 1000

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity