GEO Profile Links for Gene (Select 75469) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 1000

<< First< Prev

Page of 50

Next >Last >>

Select item 1162621571.

Spata19 - Small-molecule inhibition of BRDT effect on testis

Annotation:: Spata19, spermatogenesis associated 19

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2636548 (ID_REF), GDS5172, NM_029299, SPATA19 (ORF)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 116262157

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 939953942.

Spata19 - Gonadal development: ovaries and testes

Annotation:: Spata19, spermatogenesis associated 19

Organism:: Mus musculus

Reporter:: GPL1261, 1417863_at (ID_REF), GDS4503, 75469 (Gene ID), NM_029299

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 93995394

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 47898163.

Spata19 - Spermatogenesis and testis development time course (MG-U74C)

Annotation:: Spata19, spermatogenesis associated 19

Organism:: Mus musculus

Reporter:: GPL83, 165474_f_at (ID_REF), GDS607, 75469 (Gene ID), AV206480

DataSet type:: Expression profiling by array, count, 22 samples

ID:: 4789816

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 294313944.

Spata19 - Ribonucleoprotein- and polysome-associated mRNAs of the testis: time-course

Annotation:: Spata19, spermatogenesis associated 19

Organism:: Mus musculus

Reporter:: GPL339, 1417863_at (ID_REF), GDS2277, 75469 (Gene ID), NM_029299

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 29431394

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 424240945.

Spata19 - Taf7l deficiency effect on the testis

Annotation:: Spata19, spermatogenesis associated 19

Organism:: Mus musculus

Reporter:: GPL1261, 1417863_at (ID_REF), GDS2857, 75469 (Gene ID), NM_029299

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 42424094

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 74778836.

Spata19 - MPSS transcriptome analysis project

Annotation:: Spata19, spermatogenesis associated 19

Organism:: Mus musculus

Reporter:: GPL1010, GATCCAAGCTTCAGGACTTC (ID_REF), GDS868, BC049742

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7477883

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 1031579947.

Spata19 - Mitochondrial protease Clpp knockout effect on various tissues

Annotation:: Spata19, spermatogenesis associated 19

Organism:: Mus musculus

Reporter:: GPL11180, 1417863_PM_at (ID_REF), GDS4791, NM_029299

DataSet type:: Expression profiling by array, transformed count, 24 samples

ID:: 103157994

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 43547948.

Spata19 - Sex specific transcription in somatic and reproductive tissues

Annotation:: Spata19, spermatogenesis associated 19

Organism:: Mus musculus

Reporter:: GPL339, 1417863_at (ID_REF), GDS565, 75469 (Gene ID), NM_029299

DataSet type:: Expression profiling by array, count, 48 samples

ID:: 4354794

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 26843169.

Spata19 - Spermatogenesis time course (MG-U74C)

Annotation:: Spata19, spermatogenesis associated 19

Organism:: Mus musculus

Reporter:: GPL83, 165474_f_at (ID_REF), GDS410, 75469 (Gene ID), AV206480

DataSet type:: Expression profiling by array, count, 17 samples

ID:: 2684316

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 13268695710.

Spata19 - Diet-induced obesity model: white adipose tissue

Annotation:: Spata19, spermatogenesis associated 19

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2636548 (ID_REF), GDS6247, NM_029299, SPATA19 (ORF)

DataSet type:: Expression profiling by array, transformed count, 40 samples

ID:: 132686957

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1298807911.

Spata19 - Conjugated linoleic acid delipidative effect on obese line: time course (dye-swap)

Annotation:: Spata19, spermatogenesis associated 19

Organism:: Mus musculus

Reporter:: GPL891, 4179 (ID_REF), GDS1359, NM_029299, A_51_P301007 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 4 samples

ID:: 12988079

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 569171612.

Spata19 - Spermatogonial stem cell activity in testis laminin binding germ cells (MG-U74C )

Annotation:: Spata19, spermatogenesis associated 19

Organism:: Mus musculus

Reporter:: GPL83, 165474_f_at (ID_REF), GDS704, 75469 (Gene ID), AV206480

DataSet type:: Expression profiling by array, count, 7 samples

ID:: 5691716

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 3143089413.

Spata19 - Male germ cells

Annotation:: Spata19, spermatogenesis associated 19

Organism:: Mus musculus

Reporter:: GPL1261, 1417863_at (ID_REF), GDS2390, 75469 (Gene ID), NM_029299

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 31430894

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 203168214.

Spata19 - Ligand screen in B cells: macrophage inflammatory protein-3

Annotation:: Spata19, spermatogenesis associated 19

Organism:: Mus musculus

Reporter:: GPL260, 14559 (ID_REF), GDS312, AK005610

DataSet type:: Expression profiling by array, log ratio, 12 samples

ID:: 2031682

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4985619415.

Spata19 - Various tissues

Annotation:: Spata19, spermatogenesis associated 19

Organism:: Mus musculus

Reporter:: GPL1261, 1417863_at (ID_REF), GDS3142, 75469 (Gene ID), NM_029299

DataSet type:: Expression profiling by array, count, 70 samples

ID:: 49856194

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 176288216.

Spata19 - Ligand screen in B cells: CD27

Annotation:: Spata19, spermatogenesis associated 19

Organism:: Mus musculus

Reporter:: GPL260, 14559 (ID_REF), GDS296, AK005610

DataSet type:: Expression profiling by array, log ratio, 12 samples

ID:: 1762882

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 196448217.

Spata19 - Ligand screen in B cells: interleukin 10

Annotation:: Spata19, spermatogenesis associated 19

Organism:: Mus musculus

Reporter:: GPL260, 14559 (ID_REF), GDS308, AK005610

DataSet type:: Expression profiling by array, log ratio, 11 samples

ID:: 1964482

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7216789418.

Spata19 - Polyubiquitin knockout effect on testis: time course

Annotation:: Spata19, spermatogenesis associated 19

Organism:: Mus musculus

Reporter:: GPL1261, 1417863_at (ID_REF), GDS3906, 75469 (Gene ID), NM_029299

DataSet type:: Expression profiling by array, count, 16 samples

ID:: 72167894

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 188048219.

Spata19 - Ligand screen in B cells: growth hormone releasing hormone

Annotation:: Spata19, spermatogenesis associated 19

Organism:: Mus musculus

Reporter:: GPL260, 14559 (ID_REF), GDS303, AK005610

DataSet type:: Expression profiling by array, log ratio, 12 samples

ID:: 1880482

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 186368220.

Spata19 - Ligand screen in B cells: formyl-Met-Leu-Phe

Annotation:: Spata19, spermatogenesis associated 19

Organism:: Mus musculus

Reporter:: GPL260, 14559 (ID_REF), GDS302, AK005610

DataSet type:: Expression profiling by array, log ratio, 11 samples

ID:: 1863682

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 50

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 75469) (1000)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 1000

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity