GEO Profiles Links for Nucleotide (Select 110347544) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 1 to 20 of 1433

<< First< Prev

Page of 72

Next >Last >>

Select item 424240261.

Chl1 - Taf7l deficiency effect on the testis

Annotation:: Chl1, cell adhesion molecule L1-like

Organism:: Mus musculus

Reporter:: GPL1261, 1417795_at (ID_REF), GDS2857, 12661 (Gene ID), NM_007697

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 42424026

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 314308262.

Chl1 - Male germ cells

Annotation:: Chl1, cell adhesion molecule L1-like

Organism:: Mus musculus

Reporter:: GPL1261, 1417795_at (ID_REF), GDS2390, 12661 (Gene ID), NM_007697

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 31430826

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1092325753.

Chl1 - Diabetic db/db heart response to rosiglitazone

Annotation:: Chl1, cell adhesion molecule L1-like

Organism:: Mus musculus

Reporter:: GPL4134, 22675 (ID_REF), GDS4990, NM_007697, A_52_P441294 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 15 samples

ID:: 109232575

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 939953264.

Chl1 - Gonadal development: ovaries and testes

Annotation:: Chl1, cell adhesion molecule L1-like

Organism:: Mus musculus

Reporter:: GPL1261, 1417795_at (ID_REF), GDS4503, 12661 (Gene ID), NM_007697

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 93995326

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 270183635.

Chl1 - Lung response to Influenza A virus and Streptococcus pneumoniae infections: time course

Annotation:: Chl1, cell adhesion molecule L1-like

Organism:: Mus musculus

Reporter:: GPL1868, 640752 (ID_REF), GDS2165, NM_007697

DataSet type:: Expression profiling by array, log ratio, 7 samples

ID:: 27018363

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 129851776.

Chl1 - Conjugated linoleic acid delipidative effect on obese line: time course (dye-swap)

Annotation:: Chl1, cell adhesion molecule L1-like

Organism:: Mus musculus

Reporter:: GPL891, 1277 (ID_REF), GDS1359, NM_007697, A_51_P313348 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 4 samples

ID:: 12985177

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1297517757.

Chl1 - v-raf murine sarcoma viral oncogene homolog B-mutant thyroid carcinoma tumors

Annotation:: Chl1, cell adhesion molecule L1-like

Organism:: Mus musculus

Reporter:: GPL6246, 10540298 (ID_REF), GDS5645, NM_007697, AK040765, AK048639, AK053039, AK132840, BC060216, BC131670, BC131671, chr6:103510876-103750202 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 10 samples

ID:: 129751775

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1143253268.

Chl1 - FG-3019/gemcitabine combined-treatment effect on KPC model of pancreatic ductal adenocarcinoma

Annotation:: Chl1, cell adhesion molecule L1-like

Organism:: Mus musculus

Reporter:: GPL8321, 1417795_at (ID_REF), GDS4945, 12661 (Gene ID), NM_007697

DataSet type:: Expression profiling by array, count, 24 samples

ID:: 114325326

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 74860379.

Chl1 - MPSS transcriptome analysis project

Annotation:: Chl1, cell adhesion molecule L1-like

Organism:: Mus musculus

Reporter:: GPL1010, GATCCACTTTGACTGAATCC (ID_REF), GDS868, NM_007697

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7486037

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 7284912010.

Chl1 - Spatial and temporal development of mammalian salivary glands

Annotation:: Chl1, cell adhesion molecule L1-like

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P441294 (ID_REF), GDS3922, NM_007697, A_52_P441294 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 84 samples

ID:: 72849120

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 11626259111.

Chl1 - Small-molecule inhibition of BRDT effect on testis

Annotation:: Chl1, cell adhesion molecule L1-like

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2644008 (ID_REF), GDS5172, NM_007697, CHL1 (ORF)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 116262591

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12191627512.

Chl1 - Embryonic fibroblast response to ectopic expression of transcription factors Oct4, Sox2, Klf4, c-Myc: time course

Annotation:: Chl1, cell adhesion molecule L1-like

Organism:: Mus musculus

Reporter:: GPL6246, 10540298 (ID_REF), GDS5316, NM_007697, AK040765, AK048639, AK053039, AK132840, BC060216, BC131670, BC131671, chr6:103510876-103750202 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 24 samples

ID:: 121916275

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 9715629613.

Chl1 - SmoA1 and SmoA2 models of medulloblastoma: postnatal day 5 brain

Annotation:: Chl1, cell adhesion molecule L1-like

Organism:: Mus musculus

Reporter:: GPL9734, 100106667_TGI_at (ID_REF), GDS4495, NM_007697

DataSet type:: Expression profiling by array, count, 9 samples

ID:: 97156296

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8245820514.

Chl1 - ROR alpha1 deletion effect on skeletal muscle

Annotation:: Chl1, cell adhesion molecule L1-like

Organism:: Mus musculus

Reporter:: GPL6105, ILMN_1248706 (ID_REF), GDS3720, NM_007697

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 82458205

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 13165242015.

Chl1 - Normal liver developmental stages: embryonic and postnatal

Annotation:: Chl1, cell adhesion molecule L1-like

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P441294 (ID_REF), GDS5818, NM_007697, A_52_P441294 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 11 samples

ID:: 131652420

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2943132616.

Chl1 - Ribonucleoprotein- and polysome-associated mRNAs of the testis: time-course

Annotation:: Chl1, cell adhesion molecule L1-like

Organism:: Mus musculus

Reporter:: GPL339, 1417795_at (ID_REF), GDS2277, 12661 (Gene ID), NM_007697

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 29431326

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11890877517.

Chl1 - Mmp-8 deficient ankle joint response to the induction of arthritis

Annotation:: Chl1, cell adhesion molecule L1-like

Organism:: Mus musculus

Reporter:: GPL6246, 10540298 (ID_REF), GDS5243, NM_007697, AK040765, AK048639, AK053039, AK132840, BC060216, BC131670, BC131671, chr6:103510876-103750202 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 118908775

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10315792618.

Chl1 - Mitochondrial protease Clpp knockout effect on various tissues

Annotation:: Chl1, cell adhesion molecule L1-like

Organism:: Mus musculus

Reporter:: GPL11180, 1417795_PM_at (ID_REF), GDS4791, NM_007697

DataSet type:: Expression profiling by array, transformed count, 24 samples

ID:: 103157926

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 9179394619.

Chl1 - Oxidative stress effect on ATF4 knockout embryonic neurons

Annotation:: Chl1, cell adhesion molecule L1-like

Organism:: Mus musculus

Reporter:: GPL6100, 1500021 (ID_REF), GDS3311, NM_007697

DataSet type:: Expression profiling by array, transformed count, 24 samples

ID:: 91793946

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11894547520.

Chl1 - Ankle joint response to the induction of arthritis

Annotation:: Chl1, cell adhesion molecule L1-like

Organism:: Mus musculus

Reporter:: GPL6246, 10540298 (ID_REF), GDS5244, NM_007697, AK040765, AK048639, AK053039, AK132840, BC060216, BC131670, BC131671, chr6:103510876-103750202 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 118945475

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 72

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 110347544) (1433)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 1 to 20 of 1433

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity