GEO Profiles Links for Nucleotide (Select 12848895) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 1 to 20 of 52

<< First< Prev

Page of 3

Next >Last >>

Select item 1278413951.

Tomm40l - Rhabdomyosarcoma model

Annotation:: Tomm40l, translocase of outer mitochondrial membrane 40 homolog-like (yeast)

Organism:: Mus musculus

Reporter:: GPL6481, 105080114 (ID_REF), GDS5527, AK012264, Nr1i3 (ORF)

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 127841395

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 756686952.

Tomm40l - High, Normal, and Low Anxiety: multiple brain regions

Annotation:: Tomm40l, translocase of outer mitochondrial membrane 40 homolog-like (yeast)

Organism:: Mus musculus

Reporter:: GPL6481, 105080114 (ID_REF), GDS4002, AK012264, Nr1i3 (ORF)

DataSet type:: Expression profiling by array, count, 75 samples

ID:: 75668695

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 716853953.

Tomm40l - Fasting effect on multiple tissues: time course

Annotation:: Tomm40l, translocase of outer mitochondrial membrane 40 homolog-like (yeast)

Organism:: Mus musculus

Reporter:: GPL11012, 19895 (ID_REF), GDS3893, AK012264

DataSet type:: Expression profiling by array, log2 ratio, 122 samples

ID:: 71685395

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 625855574.

Tomm40l - Huntington disease model: brain striatum (Ref-6 V1)

Annotation:: Tomm40l, translocase of outer mitochondrial membrane 40 homolog-like (yeast)

Organism:: Mus musculus

Reporter:: GPL6333, ri|2700019J03|ZX00063A19|AK012264|1617-S (ID_REF), GDS3621, AK012264, Nr1i3 (ORF)

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 62585557

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 619851575.

Tomm40l - Eset depletion effect on embryonic stem cell

Annotation:: Tomm40l, translocase of outer mitochondrial membrane 40 homolog-like (yeast)

Organism:: Mus musculus

Reporter:: GPL6333, ri|2700019J03|ZX00063A19|AK012264|1617-S (ID_REF), GDS3599, AK012264, Nr1i3 (ORF)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 61985157

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 546357556.

Tomm40l - Skin carcinogenesis model

Annotation:: Tomm40l, translocase of outer mitochondrial membrane 40 homolog-like (yeast)

Organism:: Mus musculus

Reporter:: GPL4234, 105080114 (ID_REF), GDS3334, AK012264

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 54635755

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 499653477.

Tomm40l - Hepatocyte growth factor effect on Met receptor-knockout primary hepatocytes: time course

Annotation:: Tomm40l, translocase of outer mitochondrial membrane 40 homolog-like (yeast)

Organism:: Mus musculus

Reporter:: GPL1536, 1216893_1 (ID_REF), GDS3148, AK012264

DataSet type:: Expression profiling by array, log2 ratio, 60 samples

ID:: 49965347

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 490262458.

Tomm40l - Chronic hypoxia effect on the developing brain

Annotation:: Tomm40l, translocase of outer mitochondrial membrane 40 homolog-like (yeast)

Organism:: Mus musculus

Reporter:: GPL5402, ri|2700019J03|ZX00063A19|AK012264|1617 (ID_REF), GDS3114, AK012264

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 49026245

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 482059559.

Tomm40l - Iron overload effect on cardiac and skeletal muscles

Annotation:: Tomm40l, translocase of outer mitochondrial membrane 40 homolog-like (yeast)

Organism:: Mus musculus

Reporter:: GPL4234, 105080114 (ID_REF), GDS3086, AK012264

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 48205955

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4693525510.

Tomm40l - Histone H3 lysine 9 demethylase depletion effect on embryonic stem cells

Annotation:: Tomm40l, translocase of outer mitochondrial membrane 40 homolog-like (yeast)

Organism:: Mus musculus

Reporter:: GPL4234, 105080114 (ID_REF), GDS3037, AK012264

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 46935255

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4599405511.

Tomm40l - Histone deacetylase 5 deficient nucleus accumbens response to cocaine

Annotation:: Tomm40l, translocase of outer mitochondrial membrane 40 homolog-like (yeast)

Organism:: Mus musculus

Reporter:: GPL4234, 105080114 (ID_REF), GDS2993, AK012264

DataSet type:: Expression profiling by array, transformed count, 30 samples

ID:: 45994055

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 3219015012.

Tomm40l - Fibroblast growth factor 2 effect on embryonic fibroblast: dose response

Annotation:: Tomm40l, translocase of outer mitochondrial membrane 40 homolog-like (yeast)

Organism:: Mus musculus

Reporter:: GPL4055, ri|2700019J03|ZX00063A19|AK012264|1617-S (ID_REF), GDS2421, AK012264

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 32190150

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2966457613.

Tomm40l - Atherogenic diet effect on the liver: time course

Annotation:: Tomm40l, translocase of outer mitochondrial membrane 40 homolog-like (yeast)

Organism:: Mus musculus

Reporter:: GPL1292, AGmmB030604 (ID_REF), GDS2292, AK012264

DataSet type:: Expression profiling by array, log10 ratio, 4 samples

ID:: 29664576

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2157165614.

Tomm40l - Embryonic fibroblast-independent embryonic stem cell differentiation

Annotation:: Tomm40l, translocase of outer mitochondrial membrane 40 homolog-like (yeast)

Organism:: Mus musculus

Reporter:: GPL1942, 21656 (ID_REF), GDS1882, AK012264

DataSet type:: Expression profiling by array, log2 ratio, 4 samples

ID:: 21571656

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2157165515.

Tomm40l - Embryonic fibroblast-independent embryonic stem cell differentiation

Annotation:: Tomm40l, translocase of outer mitochondrial membrane 40 homolog-like (yeast)

Organism:: Mus musculus

Reporter:: GPL1942, 21655 (ID_REF), GDS1882, AK012264

DataSet type:: Expression profiling by array, log2 ratio, 4 samples

ID:: 21571655

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 764839716.

Tomm40l - MPSS analysis of BLK CL.4 and liver cells

Annotation:: Tomm40l, translocase of outer mitochondrial membrane 40 homolog-like (yeast)

Organism:: Mus musculus

Reporter:: GPL1010, GATCATGGTTGCTCACTTCC (ID_REF), GDS878, AK012264

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7648397

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 751069717.

Tomm40l - MPSS transcriptome analysis project

Annotation:: Tomm40l, translocase of outer mitochondrial membrane 40 homolog-like (yeast)

Organism:: Mus musculus

Reporter:: GPL1010, GATCATGGTTGCTCACTTCC (ID_REF), GDS868, AK012264

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7510697

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 221717618.

Tomm40l - Ligand screen in B cells: untreated

Annotation:: Tomm40l, translocase of outer mitochondrial membrane 40 homolog-like (yeast)

Organism:: Mus musculus

Reporter:: GPL260, 15276 (ID_REF), GDS323, AK012264

DataSet type:: Expression profiling by array, log ratio, 41 samples

ID:: 2217176

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 220037619.

Tomm40l - Ligand screen in B cells: tumor necrosis factor-alpha

Annotation:: Tomm40l, translocase of outer mitochondrial membrane 40 homolog-like (yeast)

Organism:: Mus musculus

Reporter:: GPL260, 15276 (ID_REF), GDS322, AK012264

DataSet type:: Expression profiling by array, log ratio, 11 samples

ID:: 2200376

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 218357620.

Tomm40l - Ligand screen in B cells: transforming growth factor-beta

Annotation:: Tomm40l, translocase of outer mitochondrial membrane 40 homolog-like (yeast)

Organism:: Mus musculus

Reporter:: GPL260, 15276 (ID_REF), GDS321, AK012264

DataSet type:: Expression profiling by array, log ratio, 9 samples

ID:: 2183576

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 3

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 12848895) (52)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 1 to 20 of 52

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity