GEO Profiles Links for Nucleotide (Select 12854414) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 19

Select item 1303576341.

Chd1 - Estradiol effect on uterus of EAAE estrogen receptor α DNA-binding-deficient model

Annotation:: Chd1, chromodomain helicase DNA binding protein 1

Organism:: Mus musculus

Reporter:: GPL4134, 12634 (ID_REF), GDS5664, AK015896, A_52_P474949 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 130357634

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1270458342.

Chd1 - 17β-estradiol effect on uterus of uterine epithelial ERα conditional knockout model: time course

Annotation:: Chd1, chromodomain helicase DNA binding protein 1

Organism:: Mus musculus

Reporter:: GPL4134, 12634 (ID_REF), GDS5461, AK015896, A_52_P474949 (SPOT ID)

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 127045834

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1222899343.

Chd1 - Industrial pollution effect on liver

Annotation:: Chd1, chromodomain helicase DNA binding protein 1

Organism:: Mus musculus, Mus spretus

Reporter:: GPL4134, 12634 (ID_REF), GDS5331, AK015896, A_52_P474949 (SPOT ID)

DataSet type:: Expression profiling by array, count, 19 samples

ID:: 122289934

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1153103344.

Chd1 - Glucocorticoid effect on the female liver

Annotation:: Chd1, chromodomain helicase DNA binding protein 1

Organism:: Mus musculus

Reporter:: GPL4134, 12634 (ID_REF), GDS5036, AK015896, A_52_P474949 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 115310334

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1152637345.

Chd1 - Glucocorticoid effect on the male liver

Annotation:: Chd1, chromodomain helicase DNA binding protein 1

Organism:: Mus musculus

Reporter:: GPL4134, 12634 (ID_REF), GDS5035, AK015896, A_52_P474949 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 115263734

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1092225346.

Chd1 - Diabetic db/db heart response to rosiglitazone

Annotation:: Chd1, chromodomain helicase DNA binding protein 1

Organism:: Mus musculus

Reporter:: GPL4134, 12634 (ID_REF), GDS4990, AK015896, A_52_P474949 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 15 samples

ID:: 109222534

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 716802327.

Chd1 - Fasting effect on multiple tissues: time course

Annotation:: Chd1, chromodomain helicase DNA binding protein 1

Organism:: Mus musculus

Reporter:: GPL11012, 14732 (ID_REF), GDS3893, AK015896

DataSet type:: Expression profiling by array, log2 ratio, 122 samples

ID:: 71680232

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 551849348.

Chd1 - Iron enriched and deficient diets effect on the liver

Annotation:: Chd1, chromodomain helicase DNA binding protein 1

Organism:: Mus musculus

Reporter:: GPL4134, 12634 (ID_REF), GDS3373, AK015896, A_52_P474949 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 30 samples

ID:: 55184934

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 529540369.

Chd1 - Liver response to Pacific ciguatoxin-1: time course

Annotation:: Chd1, chromodomain helicase DNA binding protein 1

Organism:: Mus musculus

Reporter:: GPL2872, 7636 (ID_REF), GDS3259, AK015896, A_52_P474949 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 9 samples

ID:: 52954036

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 5179573610.

Chd1 - Interleukin-22 effect on colon cultures

Annotation:: Chd1, chromodomain helicase DNA binding protein 1

Organism:: Mus musculus

Reporter:: GPL2872, 7636 (ID_REF), GDS3226, AK015896, A_52_P474949 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 6 samples

ID:: 51795736

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4994983011.

Chd1 - Hepatocyte growth factor effect on Met receptor-knockout primary hepatocytes: time course

Annotation:: Chd1, chromodomain helicase DNA binding protein 1

Organism:: Mus musculus

Reporter:: GPL1536, 1222314_1 (ID_REF), GDS3148, AK015896

DataSet type:: Expression profiling by array, log2 ratio, 60 samples

ID:: 49949830

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 3188203612.

Chd1 - Resveratrol and high-fat high-calorie diet effect on liver

Annotation:: Chd1, chromodomain helicase DNA binding protein 1

Organism:: Mus musculus

Reporter:: GPL2872, 7636 (ID_REF), GDS2413, AK015896, A_52_P474949 (SPOT ID)

DataSet type:: Expression profiling by array, Z-score, 14 samples

ID:: 31882036

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2158088813.

Chd1 - Embryonic fibroblast-independent embryonic stem cell differentiation

Annotation:: Chd1, chromodomain helicase DNA binding protein 1

Organism:: Mus musculus

Reporter:: GPL1942, 30888 (ID_REF), GDS1882, AK015896

DataSet type:: Expression profiling by array, log2 ratio, 4 samples

ID:: 21580888

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2158088714.

Chd1 - Embryonic fibroblast-independent embryonic stem cell differentiation

Annotation:: Chd1, chromodomain helicase DNA binding protein 1

Organism:: Mus musculus

Reporter:: GPL1942, 30887 (ID_REF), GDS1882, AK015896

DataSet type:: Expression profiling by array, log2 ratio, 4 samples

ID:: 21580887

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 761339715.

Chd1 - MPSS analysis of BLK CL.4 and liver cells

Annotation:: Chd1, chromodomain helicase DNA binding protein 1

Organism:: Mus musculus

Reporter:: GPL1010, GATCATTTTATTCCCAAAGA (ID_REF), GDS878, AK015896

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7613397

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 747569716.

Chd1 - MPSS transcriptome analysis project

Annotation:: Chd1, chromodomain helicase DNA binding protein 1

Organism:: Mus musculus

Reporter:: GPL1010, GATCATTTTATTCCCAAAGA (ID_REF), GDS868, AK015896

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7475697

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 614867117.

Fam120b - Blastocyst dormancy and activation comparison

Annotation:: Fam120b, family with sequence similarity 120, member B (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL870, 12371 (ID_REF), GDS752, AK015218, AK015896, AK018451, AK021188, AK042202, AK042739, AK049686, CL791767, BC066088, H3142E02-5_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 6 samples

ID:: 6148671

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 448147118.

Fam120b - Zygotic gene activation

Annotation:: Fam120b, family with sequence similarity 120, member B (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL870, 12371 (ID_REF), GDS579, AK015218, AK015896, AK018451, AK021188, AK042202, AK042739, AK049686, CL791767, BC066088, H3142E02-5_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 36 samples

ID:: 4481471

GEO DataSets Gene Chromosome neighbors

Select item 445817119.

Fam120b - Preimplantation development

Annotation:: Fam120b, family with sequence similarity 120, member B (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL870, 12371 (ID_REF), GDS578, AK015218, AK015896, AK018451, AK021188, AK042202, AK042739, AK049686, CL791767, BC066088, H3142E02-5_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 28 samples

ID:: 4458171

GEO DataSets Gene Profile neighbors Chromosome neighbors

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 12854414) (19)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 19

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity