GEO Profiles Links for Nucleotide (Select 12859752) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 1 to 20 of 40

<< First< Prev

Page of 2

Next >Last >>

Select item 76402181.

Prrx1 - MPSS analysis of BLK CL.4 and liver cells

Annotation:: Prrx1, paired related homeobox 1

Organism:: Mus musculus

Reporter:: GPL1010, GATCTCATGAAGTGATTCCT (ID_REF), GDS878, AK019503

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7640218

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 75025182.

Prrx1 - MPSS transcriptome analysis project

Annotation:: Prrx1, paired related homeobox 1

Organism:: Mus musculus

Reporter:: GPL1010, GATCTCATGAAGTGATTCCT (ID_REF), GDS868, AK019503

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7502518

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 61522873.

Prrx1 - Blastocyst dormancy and activation comparison

Annotation:: Prrx1, paired related homeobox 1

Organism:: Mus musculus

Reporter:: GPL870, 15987 (ID_REF), GDS752, AK008112, AK008428, AK019503, AK029347, AK031075, AK032773, AK038524, AK038736, AK048023, AK084387, K0316B09-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 6 samples

ID:: 6152287

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 44850874.

Prrx1 - Zygotic gene activation

Annotation:: Prrx1, paired related homeobox 1

Organism:: Mus musculus

Reporter:: GPL870, 15987 (ID_REF), GDS579, AK008112, AK008428, AK019503, AK029347, AK031075, AK032773, AK038524, AK038736, AK048023, AK084387, K0316B09-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 36 samples

ID:: 4485087

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 44617875.

Prrx1 - Preimplantation development

Annotation:: Prrx1, paired related homeobox 1

Organism:: Mus musculus

Reporter:: GPL870, 15987 (ID_REF), GDS578, AK008112, AK008428, AK019503, AK029347, AK031075, AK032773, AK038524, AK038736, AK048023, AK084387, K0316B09-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 28 samples

ID:: 4461787

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 22135166.

Prrx1 - Ligand screen in B cells: untreated

Annotation:: Prrx1, paired related homeobox 1

Organism:: Mus musculus

Reporter:: GPL260, 11166 (ID_REF), GDS323, AK019503

DataSet type:: Expression profiling by array, log ratio, 41 samples

ID:: 2213516

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 21967167.

Prrx1 - Ligand screen in B cells: tumor necrosis factor-alpha

Annotation:: Prrx1, paired related homeobox 1

Organism:: Mus musculus

Reporter:: GPL260, 11166 (ID_REF), GDS322, AK019503

DataSet type:: Expression profiling by array, log ratio, 11 samples

ID:: 2196716

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 21799168.

Prrx1 - Ligand screen in B cells: transforming growth factor-beta

Annotation:: Prrx1, paired related homeobox 1

Organism:: Mus musculus

Reporter:: GPL260, 11166 (ID_REF), GDS321, AK019503

DataSet type:: Expression profiling by array, log ratio, 9 samples

ID:: 2179916

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 21631169.

Prrx1 - Ligand screen in B cells: terbutaline

Annotation:: Prrx1, paired related homeobox 1

Organism:: Mus musculus

Reporter:: GPL260, 11166 (ID_REF), GDS320, AK019503

DataSet type:: Expression profiling by array, log ratio, 12 samples

ID:: 2163116

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 214631610.

Prrx1 - Ligand screen in B cells: secondary lymphoid-organ chemokine

Annotation:: Prrx1, paired related homeobox 1

Organism:: Mus musculus

Reporter:: GPL260, 11166 (ID_REF), GDS319, AK019503

DataSet type:: Expression profiling by array, log ratio, 12 samples

ID:: 2146316

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 212951611.

Prrx1 - Ligand screen in B cells: stromal cell derived factor-1

Annotation:: Prrx1, paired related homeobox 1

Organism:: Mus musculus

Reporter:: GPL260, 11166 (ID_REF), GDS318, AK019503

DataSet type:: Expression profiling by array, log ratio, 12 samples

ID:: 2129516

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 211271612.

Prrx1 - Ligand screen in B cells: sphingosine-1-phosphate

Annotation:: Prrx1, paired related homeobox 1

Organism:: Mus musculus

Reporter:: GPL260, 11166 (ID_REF), GDS317, AK019503

DataSet type:: Expression profiling by array, log ratio, 12 samples

ID:: 2112716

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 209591613.

Prrx1 - Ligand screen in B cells: prostaglandin E2

Annotation:: Prrx1, paired related homeobox 1

Organism:: Mus musculus

Reporter:: GPL260, 11166 (ID_REF), GDS316, AK019503

DataSet type:: Expression profiling by array, log ratio, 12 samples

ID:: 2095916

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 207911614.

Prrx1 - Ligand screen in B cells: platelet activating factor

Annotation:: Prrx1, paired related homeobox 1

Organism:: Mus musculus

Reporter:: GPL260, 11166 (ID_REF), GDS315, AK019503

DataSet type:: Expression profiling by array, log ratio, 11 samples

ID:: 2079116

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 206231615.

Prrx1 - Ligand screen in B cells: neuropeptide Y

Annotation:: Prrx1, paired related homeobox 1

Organism:: Mus musculus

Reporter:: GPL260, 11166 (ID_REF), GDS314, AK019503

DataSet type:: Expression profiling by array, log ratio, 11 samples

ID:: 2062316

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 204551616.

Prrx1 - Ligand screen in B cells: nerve growth factor

Annotation:: Prrx1, paired related homeobox 1

Organism:: Mus musculus

Reporter:: GPL260, 11166 (ID_REF), GDS313, AK019503

DataSet type:: Expression profiling by array, log ratio, 12 samples

ID:: 2045516

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 202871617.

Prrx1 - Ligand screen in B cells: macrophage inflammatory protein-3

Annotation:: Prrx1, paired related homeobox 1

Organism:: Mus musculus

Reporter:: GPL260, 11166 (ID_REF), GDS312, AK019503

DataSet type:: Expression profiling by array, log ratio, 12 samples

ID:: 2028716

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 201191618.

Prrx1 - Ligand screen in B cells: leukotriene B4

Annotation:: Prrx1, paired related homeobox 1

Organism:: Mus musculus

Reporter:: GPL260, 11166 (ID_REF), GDS311, AK019503

DataSet type:: Expression profiling by array, log ratio, 12 samples

ID:: 2011916

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 199511619.

Prrx1 - Ligand screen in B cells: lipopolysaccharide

Annotation:: Prrx1, paired related homeobox 1

Organism:: Mus musculus

Reporter:: GPL260, 11166 (ID_REF), GDS310, AK019503

DataSet type:: Expression profiling by array, log ratio, 12 samples

ID:: 1995116

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 197831620.

Prrx1 - Ligand screen in B cells: lysophosphatidic acid

Annotation:: Prrx1, paired related homeobox 1

Organism:: Mus musculus

Reporter:: GPL260, 11166 (ID_REF), GDS309, AK019503

DataSet type:: Expression profiling by array, log ratio, 12 samples

ID:: 1978316

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 2

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 12859752) (40)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 1 to 20 of 40

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity