GEO Profiles Links for Nucleotide (Select 242332552) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 1 to 20 of 1000

<< First< Prev

Page of 50

Next >Last >>

Select item 74898291.

Spz1 - MPSS transcriptome analysis project

Annotation:: Spz1, spermatogenic leucine zipper 1

Organism:: Mus musculus

Reporter:: GPL1010, GATCCTCAGGAGCCCGGATG (ID_REF), GDS868, NM_030237

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7489829

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 184094432.

Spz1 - Aldosterone effect on kidney cortical collecting cell line: time course

Annotation:: Spz1, spermatogenic leucine zipper 1

Organism:: Mus musculus

Reporter:: GPL2623, M200004243 (ID_REF), GDS1707, NM_030237

DataSet type:: Expression profiling by array, log2 ratio, 8 samples

ID:: 18409443

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 201980483.

Spz1 - Age effect on hematopoietic stem cells

Annotation:: Spz1, spermatogenic leucine zipper 1

Organism:: Mus musculus

Reporter:: GPL1261, 1450653_at (ID_REF), GDS1803, 79401 (Gene ID), NM_030237

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 20198048

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 294479164.

Spz1 - Ribonucleoprotein- and polysome-associated mRNAs of the testis: time-course

Annotation:: Spz1, spermatogenic leucine zipper 1

Organism:: Mus musculus

Reporter:: GPL339, 1450653_at (ID_REF), GDS2277, 79401 (Gene ID), NM_030237

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 29447916

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 314636485.

Spz1 - Male germ cells

Annotation:: Spz1, spermatogenic leucine zipper 1

Organism:: Mus musculus

Reporter:: GPL1261, 1450653_at (ID_REF), GDS2390, 79401 (Gene ID), NM_030237

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 31463648

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 424568486.

Spz1 - Taf7l deficiency effect on the testis

Annotation:: Spz1, spermatogenic leucine zipper 1

Organism:: Mus musculus

Reporter:: GPL1261, 1450653_at (ID_REF), GDS2857, 79401 (Gene ID), NM_030237

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 42456848

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 940281487.

Spz1 - Gonadal development: ovaries and testes

Annotation:: Spz1, spermatogenic leucine zipper 1

Organism:: Mus musculus

Reporter:: GPL1261, 1450653_at (ID_REF), GDS4503, 79401 (Gene ID), NM_030237

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 94028148

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1031907488.

Spz1 - Mitochondrial protease Clpp knockout effect on various tissues

Annotation:: Spz1, spermatogenic leucine zipper 1

Organism:: Mus musculus

Reporter:: GPL11180, 1450653_PM_at (ID_REF), GDS4791, NM_030237

DataSet type:: Expression profiling by array, transformed count, 24 samples

ID:: 103190748

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 43713169.

Spz1 - Sex specific transcription in somatic and reproductive tissues

Annotation:: Spz1, spermatogenic leucine zipper 1

Organism:: Mus musculus

Reporter:: GPL339, 1450653_at (ID_REF), GDS565, 79401 (Gene ID), NM_030237

DataSet type:: Expression profiling by array, count, 48 samples

ID:: 4371316

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1299125810.

Spz1 - Conjugated linoleic acid delipidative effect on obese line: time course (dye-swap)

Annotation:: Spz1, spermatogenic leucine zipper 1

Organism:: Mus musculus

Reporter:: GPL891, 7358 (ID_REF), GDS1359, NM_030237, A_51_P256500 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 4 samples

ID:: 12991258

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7220064811.

Spz1 - Polyubiquitin knockout effect on testis: time course

Annotation:: Spz1, spermatogenic leucine zipper 1

Organism:: Mus musculus

Reporter:: GPL1261, 1450653_at (ID_REF), GDS3906, 79401 (Gene ID), NM_030237

DataSet type:: Expression profiling by array, count, 16 samples

ID:: 72200648

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4417305812.

Spz1 - Diethylstilbestrol effect on the prepubertal uterus: dose response

Annotation:: Spz1, spermatogenic leucine zipper 1

Organism:: Mus musculus

Reporter:: GPL891, 7358 (ID_REF), GDS2924, NM_030237, A_51_P256500 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 6 samples

ID:: 44173058

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4988894813.

Spz1 - Various tissues

Annotation:: Spz1, spermatogenic leucine zipper 1

Organism:: Mus musculus

Reporter:: GPL1261, 1450653_at (ID_REF), GDS3142, 79401 (Gene ID), NM_030237

DataSet type:: Expression profiling by array, count, 70 samples

ID:: 49888948

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10397214814.

Spz1 - GPR120-deficient white adipose tissue response to a high fat diet

Annotation:: Spz1, spermatogenic leucine zipper 1

Organism:: Mus musculus

Reporter:: GPL1261, 1450653_at (ID_REF), GDS4811, 79401 (Gene ID), NM_030237

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 103972148

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 3882731615.

Spz1 - Pubertal mammary gland development

Annotation:: Spz1, spermatogenic leucine zipper 1

Organism:: Mus musculus

Reporter:: GPL339, 1450653_at (ID_REF), GDS2721, 79401 (Gene ID), NM_030237

DataSet type:: Expression profiling by array, transformed count, 14 samples

ID:: 38827316

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2666374816.

Spz1 - BRG1 maternally depleted embryos

Annotation:: Spz1, spermatogenic leucine zipper 1

Organism:: Mus musculus

Reporter:: GPL1261, 1450653_at (ID_REF), GDS2156, 79401 (Gene ID), NM_030237

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 26663748

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11625848917.

Spz1 - Small-molecule inhibition of BRDT effect on testis

Annotation:: Spz1, spermatogenic leucine zipper 1

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2653834 (ID_REF), GDS5172, NM_030237, SPZ1 (ORF)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 116258489

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8903584818.

Spz1 - Nitric oxide generator DETA-NONOate effect on in vitro neuronal injury model: time course

Annotation:: Spz1, spermatogenic leucine zipper 1

Organism:: Mus musculus

Reporter:: GPL1261, 1450653_at (ID_REF), GDS4408, 79401 (Gene ID), NM_030237

DataSet type:: Expression profiling by array, transformed count, 14 samples

ID:: 89035848

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7570334119.

Spz1 - Cyclophosphamide effect on bone marrow: time course

Annotation:: Spz1, spermatogenic leucine zipper 1

Organism:: Mus musculus

Reporter:: GPL13209, 021M17 (ID_REF), GDS4003, NM_030237

DataSet type:: Expression profiling by array, log2 ratio, 40 samples

ID:: 75703341

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2801264820.

Spz1 - Spinal cord and dorsal root ganglion

Annotation:: Spz1, spermatogenic leucine zipper 1

Organism:: Mus musculus

Reporter:: GPL1261, 1450653_at (ID_REF), GDS2209, 79401 (Gene ID), NM_030237

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 28012648

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 50

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 242332552) (1000)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 1 to 20 of 1000

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity