GEO Profiles Links for Nucleotide (Select 26099551) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 18

Select item 1278514991.

Tnks - Rhabdomyosarcoma model

Annotation:: Tnks, tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase

Organism:: Mus musculus

Reporter:: GPL6481, 106770184 (ID_REF), GDS5527, AK080913, B430206N15Rik (CLONE ID)

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 127851499

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 756787992.

Tnks - High, Normal, and Low Anxiety: multiple brain regions

Annotation:: Tnks, tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase

Organism:: Mus musculus

Reporter:: GPL6481, 106770184 (ID_REF), GDS4002, AK080913, B430206N15Rik (CLONE ID)

DataSet type:: Expression profiling by array, count, 75 samples

ID:: 75678799

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 625660363.

Tnks - Huntington disease model: brain striatum (Ref-6 V1)

Annotation:: Tnks, tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase

Organism:: Mus musculus

Reporter:: GPL6333, ri|B430206N15|PX00071K10|AK080913|3194-S (ID_REF), GDS3621, AK080913, B430206N15Rik (ORF)

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 62566036

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 619656364.

Tnks - Eset depletion effect on embryonic stem cell

Annotation:: Tnks, tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase

Organism:: Mus musculus

Reporter:: GPL6333, ri|B430206N15|PX00071K10|AK080913|3194-S (ID_REF), GDS3599, AK080913, B430206N15Rik (ORF)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 61965636

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 546457725.

Tnks - Skin carcinogenesis model

Annotation:: Tnks, tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase

Organism:: Mus musculus

Reporter:: GPL4234, 106770184 (ID_REF), GDS3334, AK080913

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 54645772

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 490294806.

Tnks - Chronic hypoxia effect on the developing brain

Annotation:: Tnks, tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase

Organism:: Mus musculus

Reporter:: GPL5402, ri|B430206N15|PX00071K10|AK080913|3194 (ID_REF), GDS3114, AK080913

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 49029480

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 482159727.

Tnks - Iron overload effect on cardiac and skeletal muscles

Annotation:: Tnks, tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase

Organism:: Mus musculus

Reporter:: GPL4234, 106770184 (ID_REF), GDS3086, AK080913

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 48215972

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 469452728.

Tnks - Histone H3 lysine 9 demethylase depletion effect on embryonic stem cells

Annotation:: Tnks, tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase

Organism:: Mus musculus

Reporter:: GPL4234, 106770184 (ID_REF), GDS3037, AK080913

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 46945272

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 460040729.

Tnks - Histone deacetylase 5 deficient nucleus accumbens response to cocaine

Annotation:: Tnks, tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase

Organism:: Mus musculus

Reporter:: GPL4234, 106770184 (ID_REF), GDS2993, AK080913

DataSet type:: Expression profiling by array, transformed count, 30 samples

ID:: 46004072

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 3219477610.

Tnks - Fibroblast growth factor 2 effect on embryonic fibroblast: dose response

Annotation:: Tnks, tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase

Organism:: Mus musculus

Reporter:: GPL4055, ri|B430206N15|PX00071K10|AK080913|3194-S (ID_REF), GDS2421, AK080913

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 32194776

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 763008211.

Tnks - MPSS analysis of BLK CL.4 and liver cells

Annotation:: Tnks, tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase

Organism:: Mus musculus

Reporter:: GPL1010, GATCTGGCTGTAGGAGGGGC (ID_REF), GDS878, AK080913

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7630082

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 749238212.

Tnks - MPSS transcriptome analysis project

Annotation:: Tnks, tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase

Organism:: Mus musculus

Reporter:: GPL1010, GATCTGGCTGTAGGAGGGGC (ID_REF), GDS868, AK080913

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7492382

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 615561413.

Tnks - Blastocyst dormancy and activation comparison

Annotation:: Tnks, tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase

Organism:: Mus musculus

Reporter:: GPL870, 19314 (ID_REF), GDS752, AK016121, AK048860, AK080913, AK082414, AK083986, BC057370, BZ690644, CL213263, BC011288, L0265E09-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 6 samples

ID:: 6155614

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 615189914.

Tnks - Blastocyst dormancy and activation comparison

Annotation:: Tnks, tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase

Organism:: Mus musculus

Reporter:: GPL870, 15599 (ID_REF), GDS752, AK016121, AK048860, AK080913, AK082414, AK083986, BC057370, BZ690644, CL213263, BC011288, K0210E11-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 6 samples

ID:: 6151899

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 448841415.

Tnks - Zygotic gene activation

Annotation:: Tnks, tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase

Organism:: Mus musculus

Reporter:: GPL870, 19314 (ID_REF), GDS579, AK016121, AK048860, AK080913, AK082414, AK083986, BC057370, BZ690644, CL213263, BC011288, L0265E09-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 36 samples

ID:: 4488414

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 448469916.

Tnks - Zygotic gene activation

Annotation:: Tnks, tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase

Organism:: Mus musculus

Reporter:: GPL870, 15599 (ID_REF), GDS579, AK016121, AK048860, AK080913, AK082414, AK083986, BC057370, BZ690644, CL213263, BC011288, K0210E11-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 36 samples

ID:: 4484699

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 446511417.

Tnks - Preimplantation development

Annotation:: Tnks, tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase

Organism:: Mus musculus

Reporter:: GPL870, 19314 (ID_REF), GDS578, AK016121, AK048860, AK080913, AK082414, AK083986, BC057370, BZ690644, CL213263, BC011288, L0265E09-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 28 samples

ID:: 4465114

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 446139918.

Tnks - Preimplantation development

Annotation:: Tnks, tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase

Organism:: Mus musculus

Reporter:: GPL870, 15599 (ID_REF), GDS578, AK016121, AK048860, AK080913, AK082414, AK083986, BC057370, BZ690644, CL213263, BC011288, K0210E11-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 28 samples

ID:: 4461399

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 26099551) (18)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 18

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity