GEO Profiles Links for Nucleotide (Select 27503578) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 1 to 20 of 145

<< First< Prev

Page of 8

Next >Last >>

Select item 996733321.

Orai2 - Lipopolysaccharide-stimulated, NFκB ζ inhibitor (IκBζ) deficient-peritoneal macrophages

Annotation:: Orai2, ORAI calcium release-activated calcium modulator 2

Organism:: Mus musculus

Reporter:: GPL6246, 10534570 (ID_REF), GDS4578, NM_178751, AB271215, AK087038, BC042668, BC066070, BC115648, BC115649, chr5:136147459-136170656 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 99673332

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 847860322.

Orai2 - Activated Autoimmune Regulator (AIRE)-deficient, CD8+CD28low regulatory T lymphocytes

Annotation:: Orai2, ORAI calcium release-activated calcium modulator 2

Organism:: Mus musculus

Reporter:: GPL6246, 10534570 (ID_REF), GDS4373, NM_178751, AB271215, AK087038, BC042668, BC066070, BC115648, BC115649, chr5:136147459-136170656 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 84786032

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 840968323.

Orai2 - Chlamydia muridarum genital tract infection model: CD4 T cells

Annotation:: Orai2, ORAI calcium release-activated calcium modulator 2

Organism:: Mus musculus

Reporter:: GPL6246, 10534570 (ID_REF), GDS4355, NM_178751, AB271215, AK087038, BC042668, BC066070, BC115648, BC115649, chr5:136147459-136170656 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 16 samples

ID:: 84096832

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1144034324.

Orai2 - Transforming growth factor beta effect on cytokine-activated, NOD-derived, splenic natural killer cells

Annotation:: Orai2, ORAI calcium release-activated calcium modulator 2

Organism:: Mus musculus

Reporter:: GPL6246, 10534570 (ID_REF), GDS4948, NM_178751, AB271215, AK087038, BC042668, BC066070, BC115648, BC115649, chr5:136147459-136170656 (SPOT ID)

DataSet type:: Expression profiling by array, count, 9 samples

ID:: 114403432

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 974377325.

Orai2 - Model for the manic pole of bipolar disorder: hippocampus

Annotation:: Orai2, ORAI calcium release-activated calcium modulator 2

Organism:: Mus musculus

Reporter:: GPL6246, 10534570 (ID_REF), GDS4517, NM_178751, AB271215, AK087038, BC042668, BC066070, BC115648, BC115649, chr5:136147459-136170656 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 97437732

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 74933666.

Orai2 - MPSS transcriptome analysis project

Annotation:: Orai2, ORAI calcium release-activated calcium modulator 2

Organism:: Mus musculus

Reporter:: GPL1010, GATCAGGGGTTCAAGGCCAG (ID_REF), GDS868, BC042668

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7493366

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 755592327.

Orai2 - Regulatory, pathogenic and control CD4+ T cells

Annotation:: Orai2, ORAI calcium release-activated calcium modulator 2

Organism:: Mus musculus

Reporter:: GPL6246, 10534570 (ID_REF), GDS3999, NM_178751, AB271215, AK087038, BC042668, BC066070, BC115648, BC115649, chr5:136147459-136170656 (SPOT ID)

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 75559232

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 751084328.

Orai2 - Segmented filamentous bacteria gut colonization effect on nonobese diabetic mice: T cells

Annotation:: Orai2, ORAI calcium release-activated calcium modulator 2

Organism:: Mus musculus

Reporter:: GPL6246, 10534570 (ID_REF), GDS3987, NM_178751, AB271215, AK087038, BC042668, BC066070, BC115648, BC115649, chr5:136147459-136170656 (SPOT ID)

DataSet type:: Expression profiling by array, count, 26 samples

ID:: 75108432

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1000631329.

Orai2 - APCΔ468 model of polyposis: regulatory T cells from various organs

Annotation:: Orai2, ORAI calcium release-activated calcium modulator 2

Organism:: Mus musculus

Reporter:: GPL6246, 10534570 (ID_REF), GDS4588, NM_178751, AB271215, AK087038, BC042668, BC066070, BC115648, BC115649, chr5:136147459-136170656 (SPOT ID)

DataSet type:: Expression profiling by array, count, 44 samples

ID:: 100063132

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 9683933210.

Orai2 - Heterozygous null CREB binding protein mutant response to environmental enrichment: hippocampus

Annotation:: Orai2, ORAI calcium release-activated calcium modulator 2

Organism:: Mus musculus

Reporter:: GPL6246, 10534570 (ID_REF), GDS4486, NM_178751, AB271215, AK087038, BC042668, BC066070, BC115648, BC115649, chr5:136147459-136170656 (SPOT ID)

DataSet type:: Expression profiling by array, count, 16 samples

ID:: 96839332

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 9896633211.

Orai2 - Akt transgenic response to lymphocytic choriomeningitis virus (LCMV) infection: CD8 T cell types

Annotation:: Orai2, ORAI calcium release-activated calcium modulator 2

Organism:: Mus musculus

Reporter:: GPL6246, 10534570 (ID_REF), GDS4554, NM_178751, AB271215, AK087038, BC042668, BC066070, BC115648, BC115649, chr5:136147459-136170656 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 5 samples

ID:: 98966332

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11436673212.

Orai2 - Regulatory T cell ablation effect on BDC2.5/NOD pancreatic or splenic natural killer cells: time course

Annotation:: Orai2, ORAI calcium release-activated calcium modulator 2

Organism:: Mus musculus

Reporter:: GPL6246, 10534570 (ID_REF), GDS4946, NM_178751, AB271215, AK087038, BC042668, BC066070, BC115648, BC115649, chr5:136147459-136170656 (SPOT ID)

DataSet type:: Expression profiling by array, count, 32 samples

ID:: 114366732

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11816593213.

Orai2 - Age effect on adipocytes of the bone marrow and epididymis

Annotation:: Orai2, ORAI calcium release-activated calcium modulator 2

Organism:: Mus musculus

Reporter:: GPL6246, 10534570 (ID_REF), GDS5226, NM_178751, AB271215, AK087038, BC042668, BC066070, BC115648, BC115649, chr5:136147459-136170656 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 18 samples

ID:: 118165932

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10848073214.

Orai2 - Pyrazinamide effect on pulmonary tuberculosis model : time course

Annotation:: Orai2, ORAI calcium release-activated calcium modulator 2

Organism:: Mus musculus

Reporter:: GPL6246, 10534570 (ID_REF), GDS4967, NM_178751, AB271215, AK087038, BC042668, BC066070, BC115648, BC115649, chr5:136147459-136170656 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 16 samples

ID:: 108480732

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12568913215.

Orai2 - Transcription factor E2-2 haplodeficiency effect on systemic lupus erythematosus model: splenocytes

Annotation:: Orai2, ORAI calcium release-activated calcium modulator 2

Organism:: Mus musculus

Reporter:: GPL6246, 10534570 (ID_REF), GDS5421, NM_178751, AB271215, AK087038, BC042668, BC066070, BC115648, BC115649, chr5:136147459-136170656 (SPOT ID)

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 125689132

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8697883216.

Orai2 - Gfi1b overexpression in a pro-B Abelson leukemia virus transformed cell line

Annotation:: Orai2, ORAI calcium release-activated calcium modulator 2

Organism:: Mus musculus

Reporter:: GPL6246, 10534570 (ID_REF), GDS4302, NM_178751, AB271215, AK087038, BC042668, BC066070, BC115648, BC115649, chr5:136147459-136170656 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 86978832

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11085933217.

Orai2 - Pristane-induced arthritis effect on AIRmax and AIRmin acute inflammation model: footpad

Annotation:: Orai2, ORAI calcium release-activated calcium modulator 2

Organism:: Mus musculus

Reporter:: GPL6246, 10534570 (ID_REF), GDS5052, NM_178751, AB271215, AK087038, BC042668, BC066070, BC115648, BC115649, chr5:136147459-136170656 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 110859332

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7940263218.

Orai2 - Diabetogenic BDC T-cell transfer model of type I diabetes: pancreatic islets

Annotation:: Orai2, ORAI calcium release-activated calcium modulator 2

Organism:: Mus musculus

Reporter:: GPL6246, 10534570 (ID_REF), GDS4116, NM_178751, AB271215, AK087038, BC042668, BC066070, BC115648, BC115649, chr5:136147459-136170656 (SPOT ID)

DataSet type:: Expression profiling by array, count, 13 samples

ID:: 79402632

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11078593219.

Orai2 - Pristane-induced arthritis effect on AIRmax high acute inflammation model: footpad

Annotation:: Orai2, ORAI calcium release-activated calcium modulator 2

Organism:: Mus musculus

Reporter:: GPL6246, 10534570 (ID_REF), GDS5050, NM_178751, AB271215, AK087038, BC042668, BC066070, BC115648, BC115649, chr5:136147459-136170656 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 110785932

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11408843220.

Orai2 - Gain-of-function model for conditional activation of IKK2/NF-κB in pancreatic beta-cells

Annotation:: Orai2, ORAI calcium release-activated calcium modulator 2

Organism:: Mus musculus

Reporter:: GPL6246, 10534570 (ID_REF), GDS4933, NM_178751, AB271215, AK087038, BC042668, BC066070, BC115648, BC115649, chr5:136147459-136170656 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 14 samples

ID:: 114088432

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 8

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 27503578) (145)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 1 to 20 of 145

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity