GEO Profiles Links for Nucleotide (Select 50510524) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 19

Select item 44738081.

Lcmt2 - Zygotic gene activation

Annotation:: Lcmt2, leucine carboxyl methyltransferase 2 (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL870, 4708 (ID_REF), GDS579, AK031943, AK050477, AK172970, C0949B02-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 36 samples

ID:: 4473808

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 552145422.

Lcmt2 - Iron enriched and deficient diets effect on the liver

Annotation:: Lcmt2, leucine carboxyl methyltransferase 2

Organism:: Mus musculus

Reporter:: GPL4134, 42242 (ID_REF), GDS3373, AK172970, A_52_P67983 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 30 samples

ID:: 55214542

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1153399423.

Lcmt2 - Glucocorticoid effect on the female liver

Annotation:: Lcmt2, leucine carboxyl methyltransferase 2

Organism:: Mus musculus

Reporter:: GPL4134, 42242 (ID_REF), GDS5036, AK172970, A_52_P67983 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 115339942

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1152933424.

Lcmt2 - Glucocorticoid effect on the male liver

Annotation:: Lcmt2, leucine carboxyl methyltransferase 2

Organism:: Mus musculus

Reporter:: GPL4134, 42242 (ID_REF), GDS5035, AK172970, A_52_P67983 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 115293342

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1303872425.

Lcmt2 - Estradiol effect on uterus of EAAE estrogen receptor α DNA-binding-deficient model

Annotation:: Lcmt2, leucine carboxyl methyltransferase 2

Organism:: Mus musculus

Reporter:: GPL4134, 42242 (ID_REF), GDS5664, AK172970, A_52_P67983 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 130387242

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1270754426.

Lcmt2 - 17β-estradiol effect on uterus of uterine epithelial ERα conditional knockout model: time course

Annotation:: Lcmt2, leucine carboxyl methyltransferase 2

Organism:: Mus musculus

Reporter:: GPL4134, 42242 (ID_REF), GDS5461, AK172970, A_52_P67983 (SPOT ID)

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 127075442

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1223195427.

Lcmt2 - Industrial pollution effect on liver

Annotation:: Lcmt2, leucine carboxyl methyltransferase 2

Organism:: Mus musculus, Mus spretus

Reporter:: GPL4134, 42242 (ID_REF), GDS5331, AK172970, A_52_P67983 (SPOT ID)

DataSet type:: Expression profiling by array, count, 19 samples

ID:: 122319542

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 44662168.

Lcmt2 - Preimplantation development

Annotation:: Lcmt2, leucine carboxyl methyltransferase 2 (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL870, 20416 (ID_REF), GDS578, AK084642, AK172970, L35933, L0545B11-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 28 samples

ID:: 4466216

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 327275229.

Lcmt2 - Prostate cancer progression model: stromal cell

Annotation:: Lcmt2, leucine carboxyl methyltransferase 2

Organism:: Mus musculus

Reporter:: GPL4371, 4122 (ID_REF), GDS2443, AK172970

DataSet type:: Expression profiling by array, log2 ratio, 10 samples

ID:: 32727522

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 5181400610.

Lcmt2 - Interleukin-22 effect on colon cultures

Annotation:: Lcmt2, leucine carboxyl methyltransferase 2

Organism:: Mus musculus

Reporter:: GPL2872, 25906 (ID_REF), GDS3226, AK172970, A_52_P67983 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 6 samples

ID:: 51814006

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10925214211.

Lcmt2 - Diabetic db/db heart response to rosiglitazone

Annotation:: Lcmt2, leucine carboxyl methyltransferase 2

Organism:: Mus musculus

Reporter:: GPL4134, 42242 (ID_REF), GDS4990, AK172970, A_52_P67983 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 15 samples

ID:: 109252142

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 614100812.

Lcmt2 - Blastocyst dormancy and activation comparison

Annotation:: Lcmt2, leucine carboxyl methyltransferase 2 (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL870, 4708 (ID_REF), GDS752, AK031943, AK050477, AK172970, C0949B02-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 6 samples

ID:: 6141008

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 445050813.

Lcmt2 - Preimplantation development

Annotation:: Lcmt2, leucine carboxyl methyltransferase 2 (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL870, 4708 (ID_REF), GDS578, AK031943, AK050477, AK172970, C0949B02-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 28 samples

ID:: 4450508

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 3190030614.

Lcmt2 - Resveratrol and high-fat high-calorie diet effect on liver

Annotation:: Lcmt2, leucine carboxyl methyltransferase 2

Organism:: Mus musculus

Reporter:: GPL2872, 25906 (ID_REF), GDS2413, AK172970, A_52_P67983 (SPOT ID)

DataSet type:: Expression profiling by array, Z-score, 14 samples

ID:: 31900306

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 5297230615.

Lcmt2 - Liver response to Pacific ciguatoxin-1: time course

Annotation:: Lcmt2, leucine carboxyl methyltransferase 2

Organism:: Mus musculus

Reporter:: GPL2872, 25906 (ID_REF), GDS3259, AK172970, A_52_P67983 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 9 samples

ID:: 52972306

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 615671616.

Lcmt2 - Blastocyst dormancy and activation comparison

Annotation:: Lcmt2, leucine carboxyl methyltransferase 2 (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL870, 20416 (ID_REF), GDS752, AK084642, AK172970, L35933, L0545B11-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 6 samples

ID:: 6156716

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 748208417.

Lcmt2 - MPSS transcriptome analysis project

Annotation:: Lcmt2, leucine carboxyl methyltransferase 2

Organism:: Mus musculus

Reporter:: GPL1010, GATCACTTTTTTGCTAATGT (ID_REF), GDS868, AK172970

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7482084

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 448951618.

Lcmt2 - Zygotic gene activation

Annotation:: Lcmt2, leucine carboxyl methyltransferase 2 (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL870, 20416 (ID_REF), GDS579, AK084642, AK172970, L35933, L0545B11-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 36 samples

ID:: 4489516

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 761978419.

Lcmt2 - MPSS analysis of BLK CL.4 and liver cells

Annotation:: Lcmt2, leucine carboxyl methyltransferase 2

Organism:: Mus musculus

Reporter:: GPL1010, GATCACTTTTTTGCTAATGT (ID_REF), GDS878, AK172970

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7619784

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 50510524) (19)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 19

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity