GEO Profile Links for Gene (Select 64540) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 1524

<< First< Prev

Page of 77

Next >Last >>

Select item 534793761.

Tspan4 - Fibroblast pseudopodia response to fibronectin

Annotation:: Tspan4, tetraspanin 4

Organism:: Mus musculus

Reporter:: GPL1261, 1448276_at (ID_REF), GDS3288, 64540 (Gene ID), NM_053082

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 53479376

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1153183742.

Tspan4 - Glucocorticoid effect on the female liver

Annotation:: Tspan4, tetraspanin 4

Organism:: Mus musculus

Reporter:: GPL4134, 20674 (ID_REF), GDS5036, NM_053082, A_51_P509609 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 115318374

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1152717743.

Tspan4 - Glucocorticoid effect on the male liver

Annotation:: Tspan4, tetraspanin 4

Organism:: Mus musculus

Reporter:: GPL4134, 20674 (ID_REF), GDS5035, NM_053082, A_51_P509609 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 115271774

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 44700094.

Tspan4 - Zygotic gene activation

Annotation:: Tspan4, tetraspanin 4

Organism:: Mus musculus

Reporter:: GPL870, 909 (ID_REF), GDS579, AK002709, BC003482, CL639419, C0159A09-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 36 samples

ID:: 4470009

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 44467095.

Tspan4 - Preimplantation development

Annotation:: Tspan4, tetraspanin 4

Organism:: Mus musculus

Reporter:: GPL870, 909 (ID_REF), GDS578, AK002709, BC003482, CL639419, C0159A09-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 28 samples

ID:: 4446709

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 548572766.

Tspan4 - Helicobacter pylori infection effect on a gastric epithelial progenitor cell line

Annotation:: Tspan4, tetraspanin 4

Organism:: Mus musculus

Reporter:: GPL1261, 1448276_at (ID_REF), GDS3346, 64540 (Gene ID), NM_053082

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 54857276

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 173431437.

Tspan4 - Medullary thymic epithelial cells

Annotation:: Tspan4, tetraspanin 4

Organism:: Mus musculus

Reporter:: GPL81, 97473_at (ID_REF), GDS1655, 64540 (Gene ID), AW124470

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 17343143

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 534328768.

Tspan4 - Fibroblast pseudopodia response to lysophosphatidic acid

Annotation:: Tspan4, tetraspanin 4

Organism:: Mus musculus

Reporter:: GPL1261, 1448276_at (ID_REF), GDS3287, 64540 (Gene ID), NM_053082

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 53432876

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 260605769.

Tspan4 - ERK MAP kinase inactivation during G0/G1 to S phase transition: time course

Annotation:: Tspan4, tetraspanin 4

Organism:: Mus musculus

Reporter:: GPL1261, 1448276_at (ID_REF), GDS2124, 64540 (Gene ID), NM_053082

DataSet type:: Expression profiling by array, count, 19 samples

ID:: 26060576

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6404938110.

Tspan4 - SIRT1 deficiency effect on the liver

Annotation:: Tspan4, tetraspanin 4

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P509609 (ID_REF), GDS3666, NM_053082, A_51_P509609 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 64049381

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1493364311.

Tspan4 - Growth hormone effect on adipocytes: time course

Annotation:: Tspan4, tetraspanin 4

Organism:: Mus musculus

Reporter:: GPL81, 97473_at (ID_REF), GDS1489, 64540 (Gene ID), AW124470

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 14933643

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 766629212.

Tspan4 - MPSS analysis of BLK CL.4 and liver cells

Annotation:: Tspan4, tetraspanin 4

Organism:: Mus musculus

Reporter:: GPL1010, GATCCACATTCCATGACAGT (ID_REF), GDS878, NM_053082

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7666292

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 3947664313.

Tspan4 - Brown and white adipocyte differentiation

Annotation:: Tspan4, tetraspanin 4

Organism:: Mus musculus

Reporter:: GPL81, 97473_at (ID_REF), GDS2743, 64540 (Gene ID), AW124470

DataSet type:: Expression profiling by array, count, 24 samples

ID:: 39476643

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 13036567414.

Tspan4 - Estradiol effect on uterus of EAAE estrogen receptor α DNA-binding-deficient model

Annotation:: Tspan4, tetraspanin 4

Organism:: Mus musculus

Reporter:: GPL4134, 20674 (ID_REF), GDS5664, NM_053082, A_51_P509609 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 130365674

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 9967613115.

Tspan4 - Lipopolysaccharide-stimulated, NFκB ζ inhibitor (IκBζ) deficient-peritoneal macrophages

Annotation:: Tspan4, tetraspanin 4

Organism:: Mus musculus

Reporter:: GPL6246, 10558961 (ID_REF), GDS4578, NM_001252588, NM_053082, AK211721, BC003482, BC083070, CT010285, chr7:141475240-141493422 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 99676131

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4618817616.

Tspan4 - Histone deacetylase inhibitors effect on osteoblast differentiation

Annotation:: Tspan4, tetraspanin 4

Organism:: Mus musculus

Reporter:: GPL1261, 1448276_at (ID_REF), GDS3002, 64540 (Gene ID), NM_053082

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 46188176

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6868367617.

Tspan4 - TNF receptor and lymphotoxin beta -receptor activation effect on aortic endothelial cells in vitro

Annotation:: Tspan4, tetraspanin 4

Organism:: Mus musculus

Reporter:: GPL1261, 1448276_at (ID_REF), GDS3810, 64540 (Gene ID), NM_053082

DataSet type:: Expression profiling by array, count, 5 samples

ID:: 68683676

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 3181397618.

Tspan4 - Transcription factor PU.1 knockdown effect on hematopoietic stem cells

Annotation:: Tspan4, tetraspanin 4

Organism:: Mus musculus

Reporter:: GPL1261, 1448276_at (ID_REF), GDS2411, 64540 (Gene ID), NM_053082

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 31813976

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10530237619.

Tspan4 - C-C Chemokine receptor 5 deficient lungs with melanoma metastasis: time course

Annotation:: Tspan4, tetraspanin 4

Organism:: Mus musculus

Reporter:: GPL1261, 1448276_at (ID_REF), GDS4840, 64540 (Gene ID), NM_053082

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 105302376

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 9790997620.

Tspan4 - KrasG12D pancreatic ductal epithelial cells deficient in PTEN

Annotation:: Tspan4, tetraspanin 4

Organism:: Mus musculus

Reporter:: GPL1261, 1448276_at (ID_REF), GDS4528, 64540 (Gene ID), NM_053082

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 97909976

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 77

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 64540) (1524)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 1524

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity