NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL5783 Query DataSets for GPL5783
Status Public on Aug 22, 2008
Title Nimblegen 2006 Danio rerio Gene Expression Array
Technology type in situ oligonucleotide
Distribution commercial
Organism Danio rerio
Manufacturer Nimblegen
Manufacture protocol Organism: Danio rerio
Source: Ensembl and UCSC
Build: Zv6
Probe Length: 60mer
Probes per Array: 385,000
Feature Size: 16μm x 16μm
Array Dimensions: 17.4mm x 13mm
Overall Slide Dimensions: 1" x 3" (25 x 75mm)
Recommended Storage: Store arrays desiccated at room temperature.
Catalog Number A6183-00-01
Design Name 2006-05-16 Zv6 60mer EXP
Description Danio rerio 1-Plex Array
Genes 32,292
Probes/ Target 12
Features 385,000
Replicates 1
from www.nimblegen.com
Array Synthesis
NimbleGen manufactures custom, high-density DNA arrays based on its proprietary Maskless Array Synthesizer (MAS) technology. The MAS system is a bench top, solid-state, high-density DNA array fabrication instrument comprised of a maskless light projector, a reaction chamber, a personal computer, and a DNA synthesizer. NimbleGen builds its arrays using photo-mediated synthesis chemistry with its MAS system. At the heart of the system is a Digital Micromirror Device (DMD), similar to Texas Instruments' Digital Light Processor (DLP), employing a solid-state array of miniature aluminum mirrors to pattern 786,000 to 4.2 million individual pixels of light. The DMD creates "virtual masks" that replace the physical chromium masks used in traditional arrays. These "virtual masks" reflect the desired pattern of UV light with individually addressable aluminum mirrors controlled by the computer. The DMD controls the pattern of UV light projected on the microscope slide in the reaction chamber, which is coupled to the DNA synthesizer. The UV light selectively cleaves a UV-labile protecting group at the precise location where the next nucleotide will be coupled. The patterns are coordinated with the DNA synthesis chemistry in a parallel, combinatorial manner such that 385,000 to 2.1 million unique probe features are synthesized in a single array.
Hybridization
NimbleGen Systems has developed a proprietary hybridization system, including protocols, buffers, hybridization cassettes, hardware, and temperature control instrumentation that generate highly reproducible and sensitive hybridizations. These protocols have been optimized to require minimum amounts of sample, while providing a hybridization volume that can be continually mixed over the time-course of the incubation. This method generates arrays with extremely high inter-array reproducibility (up to r2>0.99) and very low intra-array coefficient of variation (cv < 12%) across the array surface. In a typical gene expression experiment, each gene is represented by a minimum of 10 and as many as 25 probe-pairs complementary to different portions of the mRNA transcript. This guarantees that at least 10 independent measurements of mRNA concentration are included in the final value for the expression level for the gene, resulting in more reliable and reproducible gene expression calculations. In addition, these 10 to 25 probe-pairs are distributed evenly across the surface of the array. This distribution effectively eliminates problems associated with any local variation in the spatial uniformity or noise in the hybridization, because expression values are derived from a minimum of ten different locations on the array.
Catalog number A6183-00-01
 
Description Expression design for Danio rerio from ZGI release 16. Selected 9 probes per target for 43422 targets (33752 EST entries, with some represented on both strands). Several hundred targets have less than 9 probes with many as low as one probe per target. There are 1,347 targets for which we cannot select any probes.
 
Contributor(s) McReynolds LJ, Gupta S, Figueroa ME, Mullins MC, Evans T
Submission date Aug 28, 2007
Last update date Aug 22, 2008
Contact name Lisa J. McReynolds
E-mail(s) [email protected]
Organization name Albert Einstein College of Medicine
Department Developmental and Molecular Biology
Lab Todd Evans
Street address 1300 Morris Park Ave. Chanin 501
City Bronx
State/province NY
ZIP/Postal code 10461
Country USA
 
Samples (6) GSM225362, GSM225363, GSM225534, GSM225545, GSM225549, GSM225555
Series (1)
GSE8903 Comparsion of Smad1 and Smad5 Dependent Transcript Profiles in Zebrafish

Data table header descriptions
ID
CONTAINER which block was used for hybridization
DESIGN_NOTE rank selected or random
SELECTION_CRITERIA for making oligos
SEQ_ID SEQ-ID from Nimblegen for Identifying Oligos
SEQUENCE Oligo sequence
MISMATCH mismatch
MATCH_INDEX match index
FEATURE_ID Feature id
ROW_NUM Row
COL_NUM Column
PROBE_CLASS experimental
PROBE_ID Probe ID from Nimblegen
POSITION where on the chip
DESIGN_ID 3626
X coordinate
Y coordinate

Data table
ID CONTAINER DESIGN_NOTE SELECTION_CRITERIA SEQ_ID SEQUENCE MISMATCH MATCH_INDEX FEATURE_ID ROW_NUM COL_NUM PROBE_CLASS PROBE_ID POSITION DESIGN_ID X Y
3626_0001_0001 RANDOM 17-38 RANDOM_GC17_GC38 GAATTAGAGAGTCCATAGTCGCATATACGGAACACTTACCCGTTTGCAAA 0 61015560 61015560 1 1 RANDOM00001924 0 3626 1 1
3626_0023_0001 BLOCK1 rank_selected rank:07;score:129;uniq:15;freq:37;rules:0;tm:81.1 DRER0016S00014223 TTTGGGGGGGGGCATTGTGAAAGATGTGTTTAGGTGCAGGACTGTGTGATGGATCGTGTG 0 60744883 60744883 1 23 experimental DRERP00120606 635 3626 23 1
3626_0025_0001 BLOCK1 rank_selected rank:09;score:114;uniq:11;freq:37;rules:0;tm:75.6 DRER0016S00042647 TTGGATTGTTGGAAGATGGCCGTTGCTGAGAAAATGAAGGAAAATTGATAATTGCAGGAA 0 60994959 60994959 1 25 experimental DRERP00370682 393 3626 25 1
3626_0027_0001 BLOCK1 rank_selected rank:04;score:173;uniq:34;freq:37;rules:0;tm:82.4 DRER0016S00029922 CAGGGACTGTTCGGATTCGGCTCTGCCAGATCACGTTGGTCATTCATGGTTTGGGGTTGC 0 60881534 60881534 1 27 experimental DRERP00257257 329 3626 27 1
3626_0029_0001 BLOCK1 rank_selected rank:02;score:175;uniq:26;freq:37;rules:0;tm:83.1 DRER0016S00010718 CAGTATCACTGTGAGGCCAAAAATGGAGTCGGACCCCCCAAGAGCTGCCAGCACACACAC 0 60714249 60714249 1 29 experimental DRERP00089972 763 3626 29 1
3626_0031_0001 BLOCK1 rank_selected rank:05;score:133;uniq:25;freq:37;rules:0;tm:81.8 DRER0016S00028303 GAGTGTCATAGGTTTCTAGGAGGTTTGATGCAGTGATCGCCCGACCACCATCCTCGGTCT 0 60867100 60867100 1 31 experimental DRERP00242823 56 3626 31 1
3626_0033_0001 BLOCK1 rank_selected rank:01;score:007;uniq:28;freq:37;rules:0;tm:76.3 DRER0016S00029081 AACACGCATGAAGATTCGATAATACACACACTGGGGAATTCCAAGTGATACTTCTGTCAA 0 60873970 60873970 1 33 experimental DRERP00249693 79 3626 33 1
3626_0035_0001 BLOCK1 rank_selected rank:03;score:088;uniq:08;freq:37;rules:0;tm:72.9 DRER0016S00041151 TCCCTTCATGAAGATGAATCTTTGTTAGGGTGAAATACTGGTATATTTTATTGCATTGTA 0 60981771 60981771 1 35 experimental DRERP00357494 213 3626 35 1
3626_0037_0001 BLOCK1 rank_selected rank:09;score:139;uniq:22;freq:37;rules:0;tm:83.1 DRER0016S00009708 TGAGTTCTGGGCCCTGGCGAGCCTGGAGAAAAGGCACGAAAATGTGGTGCAACTGGAGGA 0 60706006 60706006 1 37 experimental DRERP00081729 498 3626 37 1
3626_0039_0001 BLOCK1 rank_selected rank:05;score:143;uniq:24;freq:37;rules:0;tm:82.4 DRER0016S00012463 AGGTATGGCTCCAGCCGCATACCTGTGTCCTGGTCCAGTAGTGGACTACTCTATAGCTGC 0 60729292 60729292 1 39 experimental DRERP00105015 599 3626 39 1
3626_0041_0001 BLOCK1 rank_selected rank:01;score:020;uniq:33;freq:37;rules:0;tm:81.8 DRER0016S00020604 TGACTAATCGGGTGAGCCAATGGCGTGTTTCCAACCTGCACTGGATGATCGCGCCTTAGT 0 60798683 60798683 1 41 experimental DRERP00174406 1126 3626 41 1
3626_0043_0001 RANDOM 17-38 RANDOM_GC17_GC38 AGCTGGGTAGGTGTCCAGATGGGGCAGTGATATCTGACGCGCACACATAG 0 61023544 61023544 1 43 RANDOM00009908 0 3626 43 1
3626_0045_0001 BLOCK1 rank_selected rank:01;score:-16;uniq:03;freq:37;rules:0;tm:70.1 DRER0016S00029604 CTAATAGTTATACTTCCACAGCTGATTGATTACATTAAAAATAGAAATATGCACAAATTA 0 60878673 60878673 1 45 experimental DRERP00254396 375 3626 45 1
3626_0047_0001 BLOCK1 rank_selected rank:01;score:032;uniq:27;freq:37;rules:0;tm:74.9 DRER0016S00043195 TGAATGTGGAAAATGAATAGATGATAGCGATGCTAACCCAAAGAGTTAAGTGCACTCTAT 0 60999820 60999820 1 47 experimental DRERP00375543 353 3626 47 1
3626_0049_0001 BLOCK1 rank_selected rank:02;score:143;uniq:24;freq:37;rules:0;tm:78.3 DRER0016S00002729 GATGCAGTTAGGAAAAAGAACGGCATTGTCGAGATTGCTGGTACAGAACGTGCGCTTTTA 0 60646708 60646708 1 49 experimental DRERP00022431 363 3626 49 1
3626_0051_0001 BLOCK1 rank_selected rank:06;score:153;uniq:27;freq:37;rules:0;tm:81.8 DRER0016S00005074 TCTAAAACAGGTTCCATTATGGCTCTGGCGGGGGTGCGTGTTATTGAGCTGGCAGGACTG 0 60666574 60666574 1 51 experimental DRERP00042297 76 3626 51 1
3626_0053_0001 BLOCK1 rank_selected rank:02;score:180;uniq:26;freq:37;rules:0;tm:79.7 DRER0016S00010037 CGCGTCTTCAGAGAATGCAGCAAACATTTCTCGGTTCCTCAGTTCGAGTCTCTCATCATC 0 60708610 60708610 1 53 experimental DRERP00084333 1180 3626 53 1
3626_0055_0001 BLOCK1 rank_selected rank:07;score:113;uniq:21;freq:37;rules:0;tm:78.3 DRER0016S00029986 GCTTTCAAAACCGGTGCAAACTGTTAAGTTACATCACAAGTGGCACACACTGTTGCCACA 0 60882109 60882109 1 55 experimental DRERP00257832 321 3626 55 1
3626_0165_0001 BLOCK1 rank_selected rank:08;score:126;uniq:28;freq:37;rules:0;tm:78.3 DRER0016S00032892 ATCTAAATGCTAAGACGGCACAGTTAAAGTGCTGCCACGTTAGCGACAATTGTGCACAAG 0 60908115 60908115 1 165 experimental DRERP00283838 599 3626 165 1
3626_0167_0001 BLOCK1 rank_selected rank:09;score:095;uniq:24;freq:37;rules:0;tm:75.6 DRER0016S00014888 GATTCGGCTAAGGACTCTACAATCAATACATCTTCCATAACTGAGGAAGCTAATGAAACT 0 60750771 60750771 1 167 experimental DRERP00126494 783 3626 167 1

Total number of rows: 392750

Table truncated, full table size 89496 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided
| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap