GEO help: Mouse over screen elements for information.
Status
Public on Mar 31, 2015
Title
nCounter Mouse Immunology Panel
Technology type
other
Distribution
commercial
Organism
Mus musculus Manufacturer
NanoString
Manufacture protocol
See manufacturer's website (http://www.nanostring.com )
Submission date
Mar 30, 2015
Last update date
Apr 24, 2017
Contact name
NanoString Technologies
Organization name
NanoString Technologies
Street address
530 Fairview Ave N | Suite 2000
City
Seattle
ZIP/Postal code
98109
Country
USA
Samples (549)
GSM2098784 , GSM2098785 , GSM2098786 , GSM2098787 , GSM2098788 , GSM2098789
GSM2098790 ,
GSM2098791 ,
GSM2098792 ,
GSM2098793 ,
GSM2098794 ,
GSM2098795 ,
GSM2098796 ,
GSM2098797 ,
GSM2098798 ,
GSM2098799 ,
GSM2098800 ,
GSM2098801 ,
GSM2098802 ,
GSM2098819 ,
GSM2098820 ,
GSM2098821 ,
GSM2098822 ,
GSM2098823 ,
GSM2098824 ,
GSM2098825 ,
GSM2098826 ,
GSM2098827 ,
GSM2098828 ,
GSM2098829 ,
GSM2098830 ,
GSM2098831 ,
GSM2098832 ,
GSM2098833 ,
GSM2098834 ,
GSM2098835 ,
GSM2098836 ,
GSM2098837 ,
GSM2098838 ,
GSM2098839 ,
GSM2098840 ,
GSM2098841 ,
GSM2098842 ,
GSM2098843 ,
GSM2098844 ,
GSM2098845 ,
GSM2098846 ,
GSM2098847 ,
GSM2098848 ,
GSM2098849 ,
GSM2098850 ,
GSM2098851 ,
GSM2098852 ,
GSM2098853 ,
GSM2099010 ,
GSM2099011 ,
GSM2099012 ,
GSM2099013 ,
GSM2099014 ,
GSM2099015 ,
GSM2099016 ,
GSM2099017 ,
GSM2099018 ,
GSM2099019 ,
GSM2099020 ,
GSM2099021 ,
GSM2099022 ,
GSM2099023 ,
GSM2140872 ,
GSM2140873 ,
GSM2140874 ,
GSM2140875 ,
GSM2140876 ,
GSM2140877 ,
GSM2140878 ,
GSM2140879 ,
GSM2140880 ,
GSM2140881 ,
GSM2140882 ,
GSM2140883 ,
GSM2140884 ,
GSM2140885 ,
GSM2140886 ,
GSM2140887 ,
GSM2140888 ,
GSM2140889 ,
GSM2140890 ,
GSM2140891 ,
GSM2140892 ,
GSM2140893 ,
GSM2140894 ,
GSM2140895 ,
GSM2140896 ,
GSM2140897 ,
GSM2140898 ,
GSM2140899 ,
GSM2140900 ,
GSM2140901 ,
GSM2140902 ,
GSM2140903 ,
GSM2140904 ,
GSM2140905 ,
GSM2160118 ,
GSM2160119 ,
GSM2160120 ,
GSM2160121 ,
GSM2160122 ,
GSM2160123 ,
GSM2160124 ,
GSM2160125 ,
GSM2160126 ,
GSM2160127 ,
GSM2160128 ,
GSM2160129 ,
GSM2433663 ,
GSM2433664 ,
GSM2433665 ,
GSM2433666 ,
GSM2433667 ,
GSM2433668 ,
GSM2433669 ,
GSM2433670 ,
GSM2433671 ,
GSM2433672 ,
GSM2433673 ,
GSM2433674 ,
GSM2462589 ,
GSM2462590 ,
GSM2462591 ,
GSM2462592 ,
GSM2462593 ,
GSM2462594 ,
GSM2462595 ,
GSM2462596 ,
GSM2462597 ,
GSM2462598 ,
GSM2462599 ,
GSM2462600 ,
GSM2462601 ,
GSM2462602 ,
GSM2462603 ,
GSM2462604 ,
GSM2462605 ,
GSM2462606 ,
GSM2462607 ,
GSM2462608 ,
GSM2462609 ,
GSM2462610 ,
GSM2462611 ,
GSM2462612 ,
GSM2462613 ,
GSM2462614 ,
GSM2462615 ,
GSM2462616 ,
GSM2462617 ,
GSM2462618 ,
GSM2462619 ,
GSM2462620 ,
GSM2462621 ,
GSM2462622 ,
GSM2462623 ,
GSM2462624 ,
GSM2462625 ,
GSM2462626 ,
GSM2462627 ,
GSM2462628 ,
GSM2462629 ,
GSM2462630 ,
GSM2462631 ,
GSM2462632 ,
GSM2462633 ,
GSM2462634 ,
GSM2462635 ,
GSM2462636 ,
GSM2585633 ,
GSM2585634 ,
GSM2585635 ,
GSM2585636 ,
GSM2585637 ,
GSM2585638 ,
GSM2585639 ,
GSM2585640 ,
GSM2585641 ,
GSM2585642 ,
GSM2585643 ,
GSM2585644 ,
GSM2585645 ,
GSM2585646 ,
GSM2585647 ,
GSM2585648 ,
GSM2585649 ,
GSM2585650 ,
GSM2585651 ,
GSM2585652 ,
GSM2585653 ,
GSM2585654 ,
GSM2585655 ,
GSM2585656 ,
GSM2713994 ,
GSM2713995 ,
GSM2713996 ,
GSM2713997 ,
GSM2713998 ,
GSM2713999 ,
GSM2714000 ,
GSM2714001 ,
GSM2714002 ,
GSM2714003 ,
GSM2714004 ,
GSM2714005 ,
GSM2714006 ,
GSM2714007 ,
GSM2714008 ,
GSM2714009 ,
GSM2714010 ,
GSM2714011 ,
GSM2714012 ,
GSM2714013 ,
GSM2714014 ,
GSM2714015 ,
GSM2714016 ,
GSM2714017 ,
GSM2714018 ,
GSM2714019 ,
GSM2714020 ,
GSM2714021 ,
GSM2714022 ,
GSM2714023 ,
GSM2714024 ,
GSM2714025 ,
GSM2714026 ,
GSM2714027 ,
GSM2714028 ,
GSM2714029 ,
GSM2714030 ,
GSM2714031 ,
GSM2714032 ,
GSM2714033 ,
GSM2714034 ,
GSM2714035 ,
GSM2714036 ,
GSM2714037 ,
GSM2714038 ,
GSM2714039 ,
GSM2714040 ,
GSM2714041 ,
GSM2714042 ,
GSM2714043 ,
GSM2714044 ,
GSM2714045 ,
GSM2714046 ,
GSM2714047 ,
GSM2714048 ,
GSM2714049 ,
GSM2714050 ,
GSM2714051 ,
GSM2714052 ,
GSM2714053 ,
GSM2779693 ,
GSM2779694 ,
GSM2779695 ,
GSM2779696 ,
GSM2779697 ,
GSM2779698 ,
GSM2779699 ,
GSM2779700 ,
GSM2779701 ,
GSM2779702 ,
GSM2779703 ,
GSM2779704 ,
GSM2779705 ,
GSM2779706 ,
GSM2779707 ,
GSM2779708 ,
GSM2779709 ,
GSM2779710 ,
GSM2779711 ,
GSM2779712 ,
GSM2779713 ,
GSM2779714 ,
GSM3163364 ,
GSM3163365 ,
GSM3163366 ,
GSM3163367 ,
GSM3163368 ,
GSM3163369 ,
GSM3163370 ,
GSM3163371 ,
GSM3163372 ,
GSM3163373 ,
GSM3163374 ,
GSM3163375 ,
GSM3723842 ,
GSM3723843 ,
GSM3723844 ,
GSM3723845 ,
GSM3723846 ,
GSM3723847 ,
GSM3723848 ,
GSM3743888 ,
GSM3743889 ,
GSM3743890 ,
GSM3743891 ,
GSM3743892 ,
GSM3743893 ,
GSM3743894 ,
GSM3743895 ,
GSM3743896 ,
GSM3743897 ,
GSM3743898 ,
GSM3743899 ,
GSM3743900 ,
GSM3743901 ,
GSM3743902 ,
GSM3743903 ,
GSM3743904 ,
GSM3743905 ,
GSM4105615 ,
GSM4105616 ,
GSM4105617 ,
GSM4105618 ,
GSM4105619 ,
GSM4105620 ,
GSM4105621 ,
GSM4105622 ,
GSM4105623 ,
GSM4105624 ,
GSM4105625 ,
GSM4105626 ,
GSM4310324 ,
GSM4310325 ,
GSM4310326 ,
GSM4310327 ,
GSM4516313 ,
GSM4516314 ,
GSM4516315 ,
GSM4516316 ,
GSM4516317 ,
GSM4516318 ,
GSM4516319 ,
GSM4516320 ,
GSM4516321 ,
GSM4516322 ,
GSM4516323 ,
GSM4516324 ,
GSM4600900 ,
GSM4600901 ,
GSM4600902 ,
GSM4600903 ,
GSM4600904 ,
GSM4600905 ,
GSM4600906 ,
GSM4600907 ,
GSM4600908 ,
GSM4600909 ,
GSM4600910 ,
GSM4600911 ,
GSM4705898 ,
GSM4705899 ,
GSM4705900 ,
GSM4705901 ,
GSM4705902 ,
GSM4705903 ,
GSM4705904 ,
GSM4705905 ,
GSM4705906 ,
GSM4705907 ,
GSM4705908 ,
GSM4705909 ,
GSM4705910 ,
GSM4705911 ,
GSM4705912 ,
GSM4705913 ,
GSM4705914 ,
GSM4705915 ,
GSM4705916 ,
GSM4705917 ,
GSM4804426 ,
GSM4804427 ,
GSM4804428 ,
GSM4804429 ,
GSM4878545 ,
GSM4878546 ,
GSM4878547 ,
GSM4878548 ,
GSM4878549 ,
GSM4878550 ,
GSM4989409 ,
GSM4989410 ,
GSM4989411 ,
GSM4989412 ,
GSM4989413 ,
GSM4989414 ,
GSM4989415 ,
GSM4989416 ,
GSM4989417 ,
GSM5144737 ,
GSM5144738 ,
GSM5144739 ,
GSM5144740 ,
GSM5144741 ,
GSM5144742 ,
GSM5144743 ,
GSM5144744 ,
GSM5144745 ,
GSM5144746 ,
GSM5144747 ,
GSM5144748 ,
GSM5144749 ,
GSM5144750 ,
GSM5144751 ,
GSM5144752 ,
GSM5144753 ,
GSM5144754 ,
GSM5144755 ,
GSM5144756 ,
GSM5144757 ,
GSM5144758 ,
GSM5144759 ,
GSM5144760 ,
GSM5144761 ,
GSM5144762 ,
GSM5144763 ,
GSM5144764 ,
GSM5144765 ,
GSM5144766 ,
GSM5144767 ,
GSM5144768 ,
GSM5144769 ,
GSM5144770 ,
GSM5144771 ,
GSM5144772 ,
GSM5487838 ,
GSM5487839 ,
GSM5487840 ,
GSM5487841 ,
GSM5487842 ,
GSM5487843 ,
GSM5487844 ,
GSM5487845 ,
GSM5487846 ,
GSM5487847 ,
GSM5487848 ,
GSM5487849 ,
GSM5769845 ,
GSM5769846 ,
GSM5769847 ,
GSM5769848 ,
GSM5769849 ,
GSM5769850 ,
GSM5769851 ,
GSM5769852 ,
GSM5769853 ,
GSM5769854 ,
GSM5769855 ,
GSM5769856 ,
GSM7055551 ,
GSM7055552 ,
GSM7055553 ,
GSM7055554 ,
GSM7102159 ,
GSM7102160 ,
GSM7102161 ,
GSM7102162 ,
GSM7102163 ,
GSM7102164 ,
GSM7432659 ,
GSM7432660 ,
GSM7432661 ,
GSM7432662 ,
GSM7432663 ,
GSM7432664 ,
GSM7432665 ,
GSM7432666 ,
GSM7432667 ,
GSM7432668 ,
GSM7432669 ,
GSM7432670 ,
GSM7432671 ,
GSM7432672 ,
GSM7432673 ,
GSM7466373 ,
GSM7466374 ,
GSM7466375 ,
GSM7466376 ,
GSM7466377 ,
GSM7466378 ,
GSM7466379 ,
GSM7466380 ,
GSM7466381 ,
GSM7466382 ,
GSM7466383 ,
GSM7466384 ,
GSM7466385 ,
GSM7466386 ,
GSM7466387 ,
GSM7518017 ,
GSM7518018 ,
GSM7518019 ,
GSM7518020 ...
Accession list truncated, click here to browse through all related public accessions You can also download a list of all accessions here Series (43)
GSE79591 Nanostring of sorted airway epithelial cells (AECs) from cell-specific MyD88 KO at 2h after in vivo sensitization with OVA/standard flagellin
GSE79592 Nanostring of sorted lung alveolar macrophages (AM) from cell-specific MyD88 KO at 6h after in vivo sensitization with OVA/standard flagellin
GSE79594 Nanostring of whole lung RNA from cell-specific MyD88 KO at 0h, 2h and 6h after in vivo sensitization with OVA/standard flagellin
GSE79614 Nanostring of sorted lung conventional dendritic cells (cDCs) from cell-specific MyD88 KO at 6h after in vivo sensitization with OVA/standard flagellin
GSE79615 MYD88-dependent dendritic and epithelial cell crosstalk in the lung orchestrates immune responses to inhaled allergens
GSE81035 Early life stress perturbs the maturation of microglia in the developing hippocampus [development]
GSE81036 Early life stress perturbs the maturation of microglia in the developing hippocampus [P14]
GSE81037 Early life stress perturbs the maturation of microglial in the developing hippocampus [P28]
GSE81038 Early life stress perturbs the maturation of microglia in the developing hippocampus
GSE81645 Using Mass Cytometry and In vivo Imaging to Study Emergency Repopulation of Immune Cells in Murine Liver
GSE92623 Intergenerational transfer of antibiotic-perturbed microbiota enhances colitis in susceptible mice.
GSE93800 Specific macronutrients exert unique influences on the adipose-liver axis to promote hepatic steatosis in mice
GSE98022 The effect of a single or multiple pulsed antibiotic exposure in C57BL/6 mice
GSE98292 A single early-in-life antibiotic course has long-lasting effect on microbial network topology and host immunity, in a murine model
GSE101721 Antibiotic-induced acceleration of type 1 diabetes alters maturation of innate intestinal immunity
GSE103721 Inflammatory Gene Changes in Spleens from WT and Rescued GR-C3 Knockin Mice Treated with LPS
GSE115029 Cestode Antigens Block LPS-induced Inflammatory Mediators and Condition Macrophages to Educate Anti-colitic T Cells
GSE129877 Role of intratumoral CD11b+ cells in immune checkpoint resistance in GBM
GSE130571 Cooperation between Constitutive and Inducible Chemokines Enables T-cell Engraftment and Immune Attack in Solid Tumors
GSE138331 Ampicillin treatment casues dysbiosis that affects transcriptome in spleen and mesenteric lymph nodes [nCounter Mouse Immunology Panel]
GSE138332 Gut dysbiosis modulates the immune response to factor VIIII in murine hemophilia A
GSE145262 Gene expression in CD8+ T-cells from tumors in Wildtype mice and β2-adrenergic receptor knockout mice
GSE149882 Profiling the inflammatory signatures of bulk MC38, Pan02 and KPC tumors from wild-type mice and Sirpα-KO mice before and after radiation therapy
GSE152043 A commensal Clostridium bacteria restricts alphavirus dissemination through a bile acid-type I IFN signaling axis
GSE155539 A High Docosahexaenoic Acid Diet Alters the Lung Inflammatory Response to Acute Dust Exposure
GSE158618 Transcriptome profile of healthy mice bone marrow hematopoietic stem cells
GSE160757 The effect of mouse cathelicidin (mCRAMP) on gene expression in CD4+ T cells cultured under Th17-driving conditions
GSE163887 Cecal microbiota transfer rescues the antibiotic-induced acceleration of type 1 diabetes and alteration of intestinal gene expression I
GSE168491 Gene expression profile in mock or virus-infected SOD1-G85R transgenic mice, a mouse model of amyotrophic lateral sclerosis
GSE181134 NanoString analysis of gene expression by compound 2D216 and/or LPS in mouse bone marrow-derived dendritic cells (BMDC)
GSE192960 Reduced RXRa signaling increases dry eye disease inducing gdT17 cells in the conjunctiva [Nanostring]
GSE195962 Reduced RXRa signaling increases dry eye disease inducing gdT17 cells in the conjunctiva
GSE225756 Galectin-3 expression in donor T cells reduces GvHD severity and lethality after allogeneic hematopoietic cell transplantation
GSE227523 Alterations in Germinal Center Formation and B Cell Activation during Severe Orientia tsutsugamushi Infection in Mice [Nanostring]
GSE233692 Nanostring mouse immunology mRNA panel - EVs isolated following exposure to WBIR were exposed onto RAW 264.7
GSE234375 Spleens from mice exposed to either 9 Gy of whole-body ionizing radiation (WBIR) and WBIR combined with a 20% total body surface area burn (RCI) and treated with mouse mesenchymal stem cell derived extracellular vesicles (MSC-EVs)
GSE236079 Gene expression panel analysis of CC10 Cre- and CC10 Cre+ RELMα flox/flox lung homogenate at day 30 post infection with Nippostrongylus brasiliensis.
GSE236081 Gene expression panel analysis of WT and RELMα KO lung homogenate at day 30 post infection with Nippostrongylus brasiliensis.
GSE236093 Myeloid and epithelial-derived RELM contribute to tissue repair following lung helminth infection
GSE243293 Nanostring of gene expression in intrahepatic leukocytes from mouse fed a chow or high-fat, -fructose, and -cholesterol (FFC) diet and treated with vehicle or a pharmacological inhibitor of the receptor for advanced glycation end products (RAGE), TTP488
GSE243294 Nanostring of gene expression in intrahepatic leukocytes from wild type (WT) or myeloid-specific RAGE knockout (RAGE-MKO) mice fed a chow or high-fat, -fructose, and -cholesterol (FFC) diet
GSE243295 Nanostring of gene expression in intrahepatic leukocytes from mice fed a high-fat, -fructose, and -cholesterol (FFC) diet
GSE253301 Nanostring analysis of neonatal brains following bacterial infection
Data table header descriptions ID Official Symbol
GB_ACC Alias Alias / Previous Symbol
Code_Class Class of target (Endogenous, Housekeeping, Negative, Positive)
SEQUENCE Official Full Name Official Full Name
Data table ID GB_ACC Alias Code_Class SEQUENCE Official Full Name Abcb10
NM_019552.2 ABC-me
Endogenous
CTGGGGCCCAGGCCTCCGTTGGTGTTGGCATGATGTTTTTTGTGTCACCAAGTCTGGCCACCTTTGTTCTGAGTGTGGTACCGCCCATCTCTGTCCTCGC
ATP-binding cassette, sub-family B (MDR/TAP), member 10
Abcb1a
NM_011076.1 mdr-3, Mdr1a, P-gp, P-glycoprotein, Pgy-3, Pgy3, multiple drug resistant 1a, Pgp, MDR3, Evi32
Endogenous
AAGGGGCTACAGGGTCTAGGCTTGCTGTGATTTTCCAGAACATAGCAAATCTTGGGACAGGAATCATCATATCCCTAATCTATGGCTGGCAACTAACACT
ATP-binding cassette, sub-family B (MDR/TAP), member 1A
Abcf1
NM_013854.1 Abc50, GCN20, D17Wsu166e
Endogenous
GAGGTGTCTTCCCGCCAGGCAATGTTAGAAAATGCATCTGACATTAAGTTGGAAAAGTTCAGCATCTCCGCCCACGGCAAGGAGCTATTCGTCAATGCTG
ATP-binding cassette, sub-family F (GCN20), member 1
Abl1
NM_009594.3 c-Abl
Endogenous
CAGGTCCATCCTCTCTGGTCCTTACCTTGATGACAAGGATCCAGCCTTCTGGTGTTTTTGAGCATTTCAAAGGTCTGCATAGAAAGGAACAGCCACTAGG
c-abl oncogene 1, non-receptor tyrosine kinase
Adal
NM_029475.1 Endogenous
AGATCTTCCTGCCCTGTGTATCCTACTCAGTTACTGCCCACTTGAAATGACTTCCCTTGAATTTGGGTAGCCAAGTATATATGGGGTCTAACTCCAGCCC
adenosine deaminase-like
Ahr
NM_013464.4 dioxin receptor, In, Ah, Ahh, Ahre, bHLHe76
Endogenous
CTGCAGACATACTTCACTGTGCAGAATCCCACATCCGCATGATTAAGACTGGAGAAAGTGGCATGACAGTTTTCCGGCTTCTTGCAAAACACAGTCGCTG
aryl-hydrocarbon receptor
Aicda
NM_009645.2 Aid
Endogenous
AATCGTGAAAGAACTTTCAAAGCCTGGGAAGGGCTACATGAAAATTCTGTCCGGCTAACCAGACAACTTCGGCGCATCCTTTTGCCCTTGTACGAAGTCG
activation-induced cytidine deaminase
Aire
NM_009646.1 Endogenous
TCCAGGAACCCGAGGGGCCGTGGAAGGGATCCTTATCCAGCAGGTGTTTGAGTCAGGAAGATCCAAGAAGTGCATTCAGGTTGGGGGAGAGTTTTATACA
autoimmune regulator (autoimmune polyendocrinopathy candidiasis ectodermal dystrophy)
App
NM_007471.2 betaAPP, Abeta, protease nexin II, Adap, Cvap, appican
Endogenous
GTGAGCGACGCCCTTCTCGTGCCCGACAAGTGCAAGTTCCTACACCAGGAGCGGATGGATGTTTGTGAGACCCATCTTCACTGGCACACCGTCGCCAAAG
amyloid beta (A4) precursor protein
Arhgdib
NM_007486.4 D4, Ly-GDI, Gdid4
Endogenous
GTTACCCGGCTTAGCCTTGTATGTGACAGTGCACCAGGACCCATCACCATGGACCTTACTGGCGATCTCGAGGCCCTCAAAAAGGATACATTTGTGCTAA
Rho, GDP dissociation inhibitor (GDI) beta
Atg16l1
NM_029846.3 APG16L, WDR30
Endogenous
TGATAGTGCTGGAGCTTACCTATTAGCAGCTTCAAATGATTTTGCAAGCCGAATCTGGACTGTGGATGATTATCGATTACGGCACACACTCACAGGCCAC
autophagy-related 16-like 1 (yeast)
Atm
NM_007499.1 Endogenous
AAACTCTCACCTTGATGAGGATCGAACAGAGGCTGCAACCAGAATCATCCACTCCATCAGAAGTAAGCGATGTAAGATGGTGAAGGACATGGAGGCGCTC
ataxia telangiectasia mutated homolog (human)
B2m
NM_009735.3 beta 2 microglobulin, beta2-m, Ly-m11
Endogenous
CTGAACTGCTACGTAACACAGTTCCACCCGCCTCACATTGAAATCCAAATGCTGAAGAACGGGAAAAAAATTCCTAAAGTAGAGATGTCAGATATGTCCT
beta-2 microglobulin
Batf
NM_016767.2 B-ATF, SFA-2
Endogenous
ACTGGACTCTCCCAGGGAAGTCGAGCCAATGTACTGGACCCAAAAAATGACAAGTCAACCCTGGACTGTCATGAATGATGCCCAAAATACACAGCACAGA
basic leucine zipper transcription factor, ATF-like
Batf3
NM_030060.2 Endogenous
CCTATGAACTTTGTGCAGCTTCGGTCAGACCCCGTGGCCAGCTGTCTACCACGATGACACCCCAGCTCACTCCTCCTTTGTCCGGCTCGGAACCTTGGTT
basic leucine zipper transcription factor, ATF-like 3
Bax
NM_007527.3 Endogenous
CATAAATTATGACATTTTCCTGGGATGAATGGGGGAAGGGGAAAGGCATTTTTCTTACTTTTGTAATTATTGGGAGGGGTGGGAATGGTGGCCTGGGGAG
BCL2-associated X protein
Bcap31
NM_012060.4 BAP31
Endogenous
GCTCCCATCCCTCTGTTGGAACCCTTTAAGTCACAGGATGAGTTTGCAGTGGACTACAGTTGCCACCTTCCTCTACGCAGAGGTCTTTGCTGTGTTGCTT
B cell receptor associated protein 31
Bcl2
NM_009741.3 Bcl-2
Endogenous
GGCCTTCTTTGAGTTCGGTGGGGTCATGTGTGTGGAGAGCGTCAACAGGGAGATGTCACCCCTGGTGGACAACATCGCCCTGTGGATGACTGAGTACCTG
B cell leukemia/lymphoma 2
Bcl3
NM_033601.3 Bcl-3
Endogenous
CCCCACTTAATCTCAGGCACCCAGGTTCCCTGTCTGGAATCCACCAGATACTCAATTCTTTGAGTGGAGGAACCAAAGGACAGCCAGCCTCTCCTCTGCC
B cell leukemia/lymphoma 3
Bcl6
NM_009744.3 Bcl5
Endogenous
ACGTTGTCATCGTGGTGAGCCGTGAGCAGTTTAGAGCCCATAAGACAGTGCTCATGGCCTGCAGCGGCCTGTTCTACAGTATCTTCACTGACCAGTTGAA
B cell leukemia/lymphoma 6
561 104 Kbytes .Supplementary data files not provided
Less...
More...