GEO help: Mouse over screen elements for information.
Status
Public on Feb 02, 2011
Title
Agilent-021169 Arabidopsis 4 Oligo Microarray (V4) (Probe Name version)
Technology type
in situ oligonucleotide
Distribution
commercial
Organism
Arabidopsis thaliana Manufacturer
Agilent Technologies
Manufacture protocol
see manufacturer's web site at http://www.agilent.com/
Description
Arabidopsis 4 Oligo Microarray (V4)
Submission date
Feb 02, 2011
Last update date
Apr 22, 2015
Organization
Agilent Technologies
E-mail(s)
[email protected] Phone
877-424-4536
URL
http://www.agilent.com Department
Street address
City
Palo Alto
State/province
CA
ZIP/Postal code
94304
Country
USA
Samples (1897)
GSM546985 , GSM546986 , GSM554343 , GSM665335 , GSM705435 , GSM705436
GSM705437 ,
GSM705438 ,
GSM705439 ,
GSM705440 ,
GSM705441 ,
GSM705442 ,
GSM774906 ,
GSM774907 ,
GSM774908 ,
GSM774909 ,
GSM774910 ,
GSM774911 ,
GSM774912 ,
GSM774913 ,
GSM790601 ,
GSM790602 ,
GSM790603 ,
GSM790604 ,
GSM790605 ,
GSM790606 ,
GSM790607 ,
GSM795503 ,
GSM795504 ,
GSM795505 ,
GSM795506 ,
GSM795507 ,
GSM795508 ,
GSM795509 ,
GSM795510 ,
GSM795511 ,
GSM795512 ,
GSM795513 ,
GSM795514 ,
GSM839365 ,
GSM839366 ,
GSM839367 ,
GSM839368 ,
GSM839369 ,
GSM839370 ,
GSM839371 ,
GSM839372 ,
GSM839373 ,
GSM839374 ,
GSM839375 ,
GSM839376 ,
GSM839377 ,
GSM839378 ,
GSM839379 ,
GSM839380 ,
GSM893932 ,
GSM893933 ,
GSM893934 ,
GSM893935 ,
GSM893936 ,
GSM893937 ,
GSM893938 ,
GSM893939 ,
GSM893940 ,
GSM893941 ,
GSM934771 ,
GSM934772 ,
GSM934773 ,
GSM934774 ,
GSM953290 ,
GSM953291 ,
GSM953292 ,
GSM953293 ,
GSM953294 ,
GSM953295 ,
GSM953296 ,
GSM953297 ,
GSM953298 ,
GSM953299 ,
GSM953300 ,
GSM953301 ,
GSM953302 ,
GSM953303 ,
GSM953304 ,
GSM953305 ,
GSM953306 ,
GSM953307 ,
GSM953308 ,
GSM953309 ,
GSM953310 ,
GSM953311 ,
GSM953312 ,
GSM953313 ,
GSM953314 ,
GSM953315 ,
GSM953316 ,
GSM953317 ,
GSM953318 ,
GSM953319 ,
GSM953320 ,
GSM953321 ,
GSM953322 ,
GSM953323 ,
GSM953324 ,
GSM953325 ,
GSM953482 ,
GSM953483 ,
GSM953484 ,
GSM953485 ,
GSM953486 ,
GSM953487 ,
GSM953488 ,
GSM953489 ,
GSM966430 ,
GSM966431 ,
GSM966432 ,
GSM966433 ,
GSM966434 ,
GSM966435 ,
GSM966436 ,
GSM966437 ,
GSM966438 ,
GSM966439 ,
GSM973419 ,
GSM973420 ,
GSM973421 ,
GSM980927 ,
GSM980928 ,
GSM980929 ,
GSM980930 ,
GSM980931 ,
GSM980932 ,
GSM980933 ,
GSM980934 ,
GSM980935 ,
GSM980936 ,
GSM980937 ,
GSM980938 ,
GSM980939 ,
GSM980940 ,
GSM980941 ,
GSM980942 ,
GSM980943 ,
GSM980944 ,
GSM980945 ,
GSM980946 ,
GSM982127 ,
GSM982128 ,
GSM982129 ,
GSM982130 ,
GSM982131 ,
GSM982132 ,
GSM982133 ,
GSM982134 ,
GSM982135 ,
GSM982136 ,
GSM982234 ,
GSM982235 ,
GSM982236 ,
GSM982237 ,
GSM982238 ,
GSM982239 ,
GSM982240 ,
GSM982241 ,
GSM982242 ,
GSM982243 ,
GSM982244 ,
GSM982245 ,
GSM982246 ,
GSM982247 ,
GSM982248 ,
GSM982249 ,
GSM982250 ,
GSM982251 ,
GSM982252 ,
GSM982253 ,
GSM982254 ,
GSM986145 ,
GSM986146 ,
GSM986147 ,
GSM986148 ,
GSM986149 ,
GSM986150 ,
GSM986151 ,
GSM986152 ,
GSM986153 ,
GSM986154 ,
GSM986155 ,
GSM986156 ,
GSM986157 ,
GSM986158 ,
GSM986159 ,
GSM986160 ,
GSM986161 ,
GSM986162 ,
GSM986163 ,
GSM986164 ,
GSM986165 ,
GSM986166 ,
GSM986167 ,
GSM986168 ,
GSM994862 ,
GSM994863 ,
GSM994864 ,
GSM994865 ,
GSM1018036 ,
GSM1018037 ,
GSM1018038 ,
GSM1018039 ,
GSM1022420 ,
GSM1022421 ,
GSM1022422 ,
GSM1031435 ,
GSM1031436 ,
GSM1031437 ,
GSM1031438 ,
GSM1031439 ,
GSM1031440 ,
GSM1031441 ,
GSM1031442 ,
GSM1031443 ,
GSM1031444 ,
GSM1031445 ,
GSM1031446 ,
GSM1031447 ,
GSM1031448 ,
GSM1031449 ,
GSM1031450 ,
GSM1031451 ,
GSM1031452 ,
GSM1031453 ,
GSM1031454 ,
GSM1031455 ,
GSM1031456 ,
GSM1031457 ,
GSM1031458 ,
GSM1031459 ,
GSM1031460 ,
GSM1031461 ,
GSM1031462 ,
GSM1032702 ,
GSM1032703 ,
GSM1037236 ,
GSM1037237 ,
GSM1037238 ,
GSM1037239 ,
GSM1037240 ,
GSM1037241 ,
GSM1037242 ,
GSM1037243 ,
GSM1037244 ,
GSM1037245 ,
GSM1037246 ,
GSM1037247 ,
GSM1045004 ,
GSM1045005 ,
GSM1045006 ,
GSM1045007 ,
GSM1045008 ,
GSM1045009 ,
GSM1045010 ,
GSM1045011 ,
GSM1045012 ,
GSM1045013 ,
GSM1045014 ,
GSM1045015 ,
GSM1045016 ,
GSM1045017 ,
GSM1045018 ,
GSM1045019 ,
GSM1045020 ,
GSM1045021 ,
GSM1045022 ,
GSM1045023 ,
GSM1045024 ,
GSM1045025 ,
GSM1045026 ,
GSM1045027 ,
GSM1075064 ,
GSM1075065 ,
GSM1075066 ,
GSM1075067 ,
GSM1075068 ,
GSM1075069 ,
GSM1075070 ,
GSM1075071 ,
GSM1084796 ,
GSM1084797 ,
GSM1084798 ,
GSM1084799 ,
GSM1095275 ,
GSM1095276 ,
GSM1095277 ,
GSM1095278 ,
GSM1099172 ,
GSM1099173 ,
GSM1099174 ,
GSM1099175 ,
GSM1099176 ,
GSM1099177 ,
GSM1099178 ,
GSM1099179 ,
GSM1099180 ,
GSM1099181 ,
GSM1099182 ,
GSM1099183 ,
GSM1099184 ,
GSM1099185 ,
GSM1099186 ,
GSM1099187 ,
GSM1099188 ,
GSM1099189 ,
GSM1099190 ,
GSM1099191 ,
GSM1099192 ,
GSM1099193 ,
GSM1099194 ,
GSM1099195 ,
GSM1099202 ,
GSM1099203 ,
GSM1099204 ,
GSM1099205 ,
GSM1099206 ,
GSM1099207 ,
GSM1099208 ,
GSM1099209 ,
GSM1099210 ,
GSM1099211 ,
GSM1099212 ,
GSM1099213 ,
GSM1099214 ,
GSM1099215 ,
GSM1099216 ,
GSM1099217 ,
GSM1099218 ,
GSM1099219 ,
GSM1099220 ,
GSM1099221 ,
GSM1099222 ,
GSM1099223 ,
GSM1099224 ,
GSM1099225 ,
GSM1108324 ,
GSM1108325 ,
GSM1108326 ,
GSM1108327 ,
GSM1108328 ,
GSM1108329 ,
GSM1108330 ,
GSM1108331 ,
GSM1108332 ,
GSM1126335 ,
GSM1126336 ,
GSM1126337 ,
GSM1126338 ,
GSM1126339 ,
GSM1126340 ,
GSM1126341 ,
GSM1126342 ,
GSM1126343 ,
GSM1126344 ,
GSM1126345 ,
GSM1126346 ,
GSM1126347 ,
GSM1126348 ,
GSM1126349 ,
GSM1126350 ,
GSM1126351 ,
GSM1126352 ,
GSM1126353 ,
GSM1126354 ,
GSM1126355 ,
GSM1126356 ,
GSM1126357 ,
GSM1126358 ,
GSM1131748 ,
GSM1131749 ,
GSM1131750 ,
GSM1131751 ,
GSM1131752 ,
GSM1131753 ,
GSM1131754 ,
GSM1131755 ,
GSM1131756 ,
GSM1131757 ,
GSM1131758 ,
GSM1131759 ,
GSM1131760 ,
GSM1131761 ,
GSM1131762 ,
GSM1131763 ,
GSM1131764 ,
GSM1131765 ,
GSM1131766 ,
GSM1131767 ,
GSM1131768 ,
GSM1131769 ,
GSM1131770 ,
GSM1131771 ,
GSM1131772 ,
GSM1131773 ,
GSM1131774 ,
GSM1132649 ,
GSM1132650 ,
GSM1132651 ,
GSM1132652 ,
GSM1132653 ,
GSM1132654 ,
GSM1138217 ,
GSM1138218 ,
GSM1138219 ,
GSM1138220 ,
GSM1138221 ,
GSM1138222 ,
GSM1138223 ,
GSM1138224 ,
GSM1138225 ,
GSM1138226 ,
GSM1138227 ,
GSM1138228 ,
GSM1138229 ,
GSM1138230 ,
GSM1138231 ,
GSM1138232 ,
GSM1138233 ,
GSM1138234 ,
GSM1138235 ,
GSM1138236 ,
GSM1138237 ,
GSM1138238 ,
GSM1138239 ,
GSM1138240 ,
GSM1138241 ,
GSM1138242 ,
GSM1138243 ,
GSM1138244 ,
GSM1138245 ,
GSM1138246 ,
GSM1138247 ,
GSM1138248 ,
GSM1138249 ,
GSM1138250 ,
GSM1138251 ,
GSM1138252 ,
GSM1138253 ,
GSM1138254 ,
GSM1138255 ,
GSM1138256 ,
GSM1138257 ,
GSM1138258 ,
GSM1138259 ,
GSM1138260 ,
GSM1138261 ,
GSM1138262 ,
GSM1138263 ,
GSM1138264 ,
GSM1138265 ,
GSM1138266 ,
GSM1138267 ,
GSM1138268 ,
GSM1138269 ,
GSM1138270 ,
GSM1138271 ,
GSM1138272 ,
GSM1138273 ,
GSM1138274 ,
GSM1138275 ,
GSM1138276 ,
GSM1138277 ,
GSM1172740 ,
GSM1172741 ,
GSM1172742 ,
GSM1172743 ,
GSM1172744 ,
GSM1172745 ,
GSM1172746 ,
GSM1172747 ,
GSM1172748 ,
GSM1172749 ,
GSM1172750 ,
GSM1172751 ,
GSM1172752 ,
GSM1172753 ,
GSM1172754 ,
GSM1172755 ,
GSM1172756 ,
GSM1172757 ,
GSM1172758 ,
GSM1172759 ,
GSM1172760 ,
GSM1172761 ,
GSM1172762 ,
GSM1172763 ,
GSM1172764 ,
GSM1172765 ,
GSM1172766 ,
GSM1172767 ,
GSM1172768 ,
GSM1172769 ,
GSM1172770 ...
Accession list truncated, click here to browse through all related public accessions You can also download a list of all accessions here Series (141)
GSE22000 The Arabidopsis Aminopeptidase LAP2 Regulates Plant Growth, Leaf Longivity and Stress Response
GSE22277 Arabidopsis thaliana ecotype Columbia [Col-0]: incubated with E. coli vs. Control
GSE27006 Arabidopsis thaliana ecotype Columbia [Col-0]): incubated with yeast (saccharomyces cerevisiae) vs. Control
GSE28493 dehydration response: dcp5-1 and WT
GSE31268 Arabidopsis thaliana wild type and PDKO3 mutant mechanical damage (MD) vs herbivore wounding (HW)
GSE31886 Transcriptomes of 35S:MYB106VP16 and wild-type Arabidopsis seedling
GSE31887 Functional analysis of Arabidopsis MYB106 and WIN1/SHN1 transcription factors
GSE32087 Expression data in an Arabidopsis cytokinin-deficient mutant, ipt1,3,5,7 and its wild type plant (Col-0) under high salinity and control conditions.
GSE33951 Identification of target genes of ABI3 [Agilent 44k]
GSE34043 Identification of target genes of ABI3
GSE36447 Transcriptional analysis for cell-cell communication during graft union development in Arabidopsis
GSE38111 Global transcriptome analysis of tarani (tni)
GSE38986 Microarray analysis of Atelp2, npr1 and wild type (Col-0) infected with the avirulent bacterial pathogen Pst DC3000/avrRpt2
GSE38999 Microarray analysis of At-med16-1 and wild type (Col-0) infected with the avirulent bacterial pathogen Pst DC3000/avrRpt2
GSE39347 Arabidopsis hsi2 vs. Col-0 Drought Arrays
GSE39630 Transcriptional Analysis of lsm1a lsm1b Arabidopsis mutant.
GSE39898 Arabidopsis thaliana Wild-type vs. mutant sdg2
GSE39947 Arabidopsis ult1-3 mutant restored LFYasEMF1's phenotype
GSE39956 Combined stress treatment of high salinity, osmotic pressure and heat to Arabidopsis thaliana
GSE40139 Identification of WRKY22 targets under submergence in Arabidopsis (mRNA)
GSE40140 Identification of WRKY22 targets under submergence in Arabidopsis
GSE40485 Identification of target genes of the DELLA protein RGL2 during the repression of seed germination
GSE41478 Arabidopsis thaliana vegetative part: Col-0 vs. shr scl23 scr triple mutant
GSE41682 Transcription factor AtDOF4.2 regulates shoot branching and seed coat formation in Arabidopsis
GSE42053 Plant Elongator in light signaling
GSE42113 Trichoderma-plant root colonization: escaping early plant defense responses and activation of the antioxidant machinery
GSE42290 Expression data in an Arabidopsis cytokinin (CK)-signaling mutant, ahp2,3,5 and its wild type plant (Col-0) under drought and well-water (control) conditions.
GSE42552 JA-INDUCIBLE MYC2-LIKE1 acts as a repressor and negatively regulates jasmonate signaling in Arabidopsis
GSE43964 Microarray analysis of scap1 mutant and wild type in Arabidopsis thaliana guard cell protoplast
GSE44419 Expression data of WT (NCED3pro:LUC transgenic plants, gl1 Columbia background) and ced2 under osmotic stress
GSE44984 Plant growth in Arabidopsis is assisted by whole soil microbial communities
GSE45212 Microarray analysis of med14 and wild type (Col-0) infected with the avirulent bacterial pathogen Pst DC3000/avrRpt2
GSE45214 Microarray analysis of med14, med16, npr1, and wild type (Col-0) infected with the avirulent bacterial pathogen Pst DC3000/avrRpt2
GSE45215 Microarray analyses of pathogen-induced transcriptome changes in the Arabidopsis mutant med14
GSE45543 Microarray analysis of transcriptional responses to abscisic acid and salt stress in Arabidopsis thaliana
GSE46208 A spatiotemporal understanding of growth regulation during the salt-stress response (Agilent)
GSE46524 Expression data in Arabidopsis Col-0 with acetic acid treatment and subsequent drought treatment
GSE46574 bHLH transcription factors facilitating K+ uptake during stomatal opening are repressed by abscisic acid through phosphorylation
GSE46757 Simultaneous application of heat, drought and virus to Arabidopsis thaliana plants reveals significant shifts in signaling networks [triple_stress]
GSE46758 Simultaneous application of heat, drought and virus to Arabidopsis thaliana plants reveals significant shifts in signaling networks [severe_triple]
GSE46759 Simultaneous application of heat, drought and virus to Arabidopsis thaliana plants reveals significant shifts in signaling networks [triple_wdh]
GSE46760 Simultaneous application of heat, drought and virus to Arabidopsis thaliana plants reveals significant shifts in signaling networks
GSE48207 Microarray analysis of elp2 and wild type (Col-0) infected with the necrotrophic fungal pathogen Botrytis cinerea
GSE48854 Transcriptome analysis of Atasf1 mutants in comparison with wild type.
GSE48949 Comparative expression analysis of the Arabidopsis strigolactone (SL)-response mutant, max2-3, and wild type (WT) plants (Col-0) under dehydration conditions.
GSE51767 Construction of gene expression profiles for anoxia-reoxygenation in Arabidopsis
GSE52326 Arabidopsis AtbHLH112 protein binds to the G-box and a novel motif GCG-box to regulate gene expression in response to abiotic stress
GSE52979 Response to different N-acyl homoserine lactones and N-acyl homoserine lactones-pretreated plants to secondary challenge with flg22.
GSE53113 VuDREB2A activated transcription in wild type Arabidopsis: VuDREB2A overexpressor lines vs. wild type Arabidopsis
GSE54469 Identification of genes cooperatively regulated by cytokinin and HD-ZIP III transcription factors
GSE55167 Arabidopsis thaliana seedlings: Wild type vs. sdg26, atx1, sdg25, clf, ldl1 ldl2 and combined mutants
GSE55684 PSY1 responding transcripts in two plant lines of Arabidopsis thaliana
GSE55956 Arabidopsis Col vs vim1,2,3 triple mutant
GSE56497 Arabidopsis buds: ahl16 vs. Col-0
GSE57035 Physiological, biochemical and genome-wide transcriptional analysis reveals that elevated CO2 mitigates the impact of combined heat wave and drought stress in Arabidopsis thaliana at multiple organizational levels
GSE57174 Gene expression of flower buds between rdr6-15 and wild-type under drought stress condition
GSE57742 Transcriptomic effects of the expression in Arabidopsis of a TCP15-EAR fusion controlled by its own promoter (one-color experiment)
GSE57743 Transcriptomic effects of the expression in Arabidopsis of a TCP15-EAR fusion controlled by its own promoter (two-color experiment)
GSE57744 Transcriptomic effects of the expression in Arabidopsis of a TCP15-EAR fusion controlled by its own promoter
GSE57847 ThERF1 regulates its target genes via binding a novel cis-acting element in response to salt stress
GSE59048 Coordinate Regulation of Metabolites Glycosylation and Stress Hormones Biosynthesis by TT8 in Arabidopsis
GSE59315 ß-amylase1 mutant Arabidopsis plants show improved drought tolerance due to reduced starch breakdown in guard cells
GSE59321 ß-amylase1 mutant Arabidopsis plants show improved drought tolerance due to reduced starch breakdown in guard cells
GSE60260 Arabidopsis AtbHLH112 protein positively regulates tolerance to abiotic stress and binds to the E-box and a novel motif GCG-box
GSE60306 Transcriptome analysis of Atino80-5 mutant in comparison with wild type.
GSE60975 Root and rosette leaves transcriptome of Arabidopsis Col-0 and nrt1.5 mutant
GSE61595 Choline transporter-like1 is required for plasmodesmal targeting of Potato leafroll virus movement protein MP17 and long-distance assimilate transport
GSE62888 The ThbZIP1 can be regulated by an ABF Transcription Factor and sensitivity to ABA treatment
GSE64070 Development of gene expression signatures for 4 days of waterlogging stress in Arabidopsis thaliana Col-0 plants
GSE65165 Microarray analysis of med16, med8, elp2, and wild type (Col-0) infected with the necrotrophic fungal pathogen Sclerotinia sclerotiorum
GSE65332 Transcriptome changes for Hirschfeldia incana in response to lead exposure
GSE65333 Transcriptome changes for Arabidopsis thaliana in response to lead exposure
GSE65334 Transcriptome changes in response to lead exposure
GSE65460 Microarray analysis to identify the differentially expressed genes induced by NROB
GSE66020 The transcriptomics of an evolved plant-virus gene-for-gene interaction
GSE66105 ß-amylase1 mutant Arabidopsis plants show improved drought tolerance due to reduced starch breakdown in guard cells
GSE66201 Transcriptomic responses in Arabidopsis thaliana to PIPL3 peptide treatment
GSE66946 Characterization of differential gene expression profiles between wild-type Ler and proatcape1 mutant seedlings upon salt stress.
GSE67356 Increased level of glutathione contributes to stress tolerances and global translational changes in Arabidopsis
GSE67544 Transcriptional response of Arabidopsis sweet11/sweet12 double mutants upon Colletotrichum higginsianum infection
GSE69349 Stimulation of cell elongation by tetraploidy in hypocotyls of dark-grown Arabidopsis seedlings
GSE71767 ANAC046, a NAC family transcription factor, is involved in leaf senescence by controlling the chlorophyll catabolic gene expression in Arabidopsis
GSE71914 Arabidopsis Me-0 vs tetraploid Col
GSE71927 Overlapping and antagonistic genes affected in the sdg8, sdg26 and sdg8 sdg26 mutants
GSE72168 Transcriptome changes in Arabidopsis expressing Vitreoscilla hemoglobin under hypoxic and NO donor treatments.
GSE74880 The Arabidopsis type-B cytokinin response regulators ARR1, ARR10 and ARR12 negatively regulate plant responses to drought
GSE76244 Arabidopsis thaliana seedlings: Wild type vs. zrf1 mutants
GSE76568 Microarray analysis of exogenous NAD+-induced transcriptome changes in Arabidopsis thaliana
GSE77467 The IDA-LIKE peptides IDL6 and IDL7 are negative modulators of stress responses in Arabidopsis thaliana
GSE77673 Expressions of Cardamine amara, hirsuta and flexuorsa under wet and dry conditions
GSE79025 PAMP-induced secreted peptide 1, PIP1 (At4g28460) and PIP2 (At4g37290) are negative modulators of immunity in Arabidopsis thaliana
GSE81039 Newly identified AP2-ERF transcription factors produce thickened primary cell wall in fiber cells of nst1 nst3 double mutant in Arabidopsis
GSE81229 Transcriptome analysis of as1-1, tfl2-1 and as1-1 tfl2-1 mutants in comparison with wild type.
GSE81634 Allyl-isothiocyanate treatment induces a complex transcriptional reprogramming including heat stress, oxidative stress and plant defense responses in Arabidopsis thaliana
GSE84087 The function of OsbHLH068 is partially redundant with its homolog, AtbHLH112, in the regulation of the salt stress response but has opposite functions to control flowering in Arabidopsis
GSE84221 Gene expression profile for SvGRP-transformant and WT Arabidopsis seedlings under salt stress
GSE84570 Identification of A Novel bZIP Transcription Factor in Camellia sinensis as A Negative Regulator of Freezing Tolerance in Transgenic Arabidopsis
GSE85593 Transcriptome analysis of Al stress response genes (Al stress induced genes and repressed genes) in Arabidopsis
GSE87591 Expression data from epidermis specific phytochrome B or global phytochrome B line comparing to phyB-9 mutant.
GSE87723 Differentially expressed genes between non-treated and salt-treated WT plants
GSE88922 The Arabidopsis N-acetylornithine deacetylase controls ornithine biosynthesis via a linear pathway with downstream effects on polyamine levels.
GSE90622 Comparative expression analysis of the Arabidopsis karrikin (KAR)-receptor mutant, kai2-2, and wild type (WT) plants (Col-0) under dehydration conditions
GSE93084 XVE AMY3C-EY induction in SAM
GSE93312 Arabidopsis ila3 mutant seedlings versus wild-type seedlings.
GSE94731 Arabidopsis thaliana Wild-type vs. mutant (PcG)
GSE94885 Expression data in an Arabidopsis cytokinin (CK)-signaling mutant, ahp2,3,5 and arr1,10,12, and its wild type plant (WT, Col-0) under high salinity (200 mM NaCl) and control (0 mM NaCl) conditions.
GSE95614 Comparative expression analysis of the Arabidopsis CK-signaling ahp4-1 mutant and wild type (WT) plants (Col-0) under dehydration conditions
GSE99664 The SALT HYPERSENSITIVE MUTANT 9, a nucleolar APUM23 protein, is essential for salt sensitivity in association with ABA signal pathways in Arabidopsis thaliana
GSE100525 Toxic metal tolerance of Arabidopsis arenosa inoculated with fungal endophyte Mucor sp. Gene expression study
GSE100815 bli-1 12 DAG continuous light grown whole seedlings analyzed on a 44k single color Agilent microarray
GSE102714 Transcript profiling upon overexpressing an AP2/ERF transcription factor Rap2.9 in A. thaliana
GSE102948 STOP1 overexpressor vs. Col-0 and stop1 knockout vs Col-0 under control and NaCl
GSE105401 Genome-wide gene expression analysis for co-induction of ISH1 and ISH2 in the Arabidopsis
GSE110439 Study of the function of COX17 by transcriptional profiling of Arabidopsis thaliana cox17-2 mutant plants with COX17-1 silenced by amiRNA (amiCOX17-1/cox17-2 plants)
GSE110461 Study of the function of COX19 by transcriptional profiling of Arabidopsis thaliana transformed with artificial microRNA to reduce expression of COX19
GSE114689 Study of the function of AtOXR2 in stress response by transcriptional profiling of Arabidopsis thaliana with incresed expression of AtOXR2 (oeOXR2 plants)
GSE116647 Genome-wide profiling of gamma-ray-responsive transcriptomes from Arabidopsis thaliana ecotype Col-0
GSE117688 Gene expression analysis of Arabidopsis thaliana inoculated with fungal endophyte Mucor sp. 5 days after inoculation
GSE117689 Gene expression analysis of Arabidopsis thaliana inoculated with fungal endophyte Mucor sp. 10 days after inoculation
GSE124921 Invasion by diverse fungal pathogens in Arabidopsis thaliana commonly activates both tryptophan-dependent and independent defense pathways exhibiting distinct sensitivity to the bak1-5 mutation
GSE128424 Comparative expression analysis of the Arabidopsis strigolactone (SL)-receptor mutant, d14-1, and wild type (WT) plants (Col-0) under dehydration conditions.
GSE136779 Arabidopsis seedlings: wild-type vs. gcn20
GSE139089 The role of a glucosinolate-derived nitrile in plant immune responses
GSE139100 Blue light regulates phosphate deficiency-dependent primary root growth inhibition in Arabidopsis
GSE143778 Microarray analysis of wild-type (WT; Ler-0) and smn2-90 mutants to identify SMN2-regulated defense-related genes
GSE151256 Expression Data from Arabidopsis axs1-1 axs2-1/+ mutant
GSE157774 Arabidopsis CURLY LEAF functions in leaf immunity against fungal pathogens by concomitantly repressing SEPALLATA3 and activating plant defensins
GSE161564 Arabidopsis Ethylene Response Factor 19 : 35S::ERF19
GSE162759 Gene expression during Arabidopsis ovule development at stages 9-12
GSE162891 Jasmonates and Histone deacetylase 6 activate Arabidopsis genome-wide histone acetylation and methylation during the early acute stress response
GSE167174 WIND1 orchestrates wound-induced callus formation, vascular reconnection and defense response in Arabidopsis
GSE168830 Transcriptomic profiling of Arabidopsis seedlings in response to mono-rhamnolipids from Pseudomonas aeruginosa secretome
GSE180205 Impacts of phosphatidylglycerol on plastid gene expression and light induction of nuclear photosynthetic genes
GSE181871 Thorough investigation of genes responsive to brassinosteroid in Arabidopsis
GSE196838 Comparative expression analysis of the Arabidopsis smax1 smxl2 under dehydration conditions
GSE200100 Karrikin Receptor KARRIKIN INSENSITIVE2 Positively Regulates Heat Stress Tolerance in Arabidopsis thaliana
GSE216293 Gene expression signatures in Arabidopsis thaliana roots under sufficient nitrogen or mild nitrogen deficiency
GSE217790 Expression signatures of Arabidopsis thaliana roots under low or high phosphate conditions.
GSE251661 Arabidopsis thaliana: transgenic plants vs wild type
GSE261985 GABA does not regulate stomatal CO2 signalling in Arabidopsis
GSE264404 Quantification of salinity-induced gene expression in young AGB1-deficient roots
Relations Alternative to
GPL9020
Data table header descriptions ID Agilent feature number
SPOT_ID Spot identifier
CONTROL_TYPE Control type
REFSEQ RefSeq Accession number
GB_ACC GenBank Accession number
GENE Entrez Gene ID
GENE_SYMBOL Gene Symbol
GENE_NAME Gene Name
UNIGENE_ID UnigeneID
ENSEMBL_ID EnsemblID
ACCESSION_STRING Accession String
CHROMOSOMAL_LOCATION Chromosomal Location
DESCRIPTION Description
GO_ID GoIDs
SEQUENCE Sequence
Data table ID SPOT_ID CONTROL_TYPE REFSEQ GB_ACC GENE GENE_SYMBOL GENE_NAME UNIGENE_ID ENSEMBL_ID ACCESSION_STRING CHROMOSOMAL_LOCATION DESCRIPTION GO_ID SEQUENCE (+)E1A_r60_1
(+)E1A_r60_1
pos
(+)E1A_r60_3
(+)E1A_r60_3
pos
(+)E1A_r60_a104
(+)E1A_r60_a104
pos
(+)E1A_r60_a107
(+)E1A_r60_a107
pos
(+)E1A_r60_a135
(+)E1A_r60_a135
pos
(+)E1A_r60_a20
(+)E1A_r60_a20
pos
(+)E1A_r60_a22
(+)E1A_r60_a22
pos
(+)E1A_r60_a97
(+)E1A_r60_a97
pos
(+)E1A_r60_n11
(+)E1A_r60_n11
pos
(+)E1A_r60_n9
(+)E1A_r60_n9
pos
(+)eQC-39
(+)eQC-39
pos
(+)eQC-40
(+)eQC-40
pos
(+)eQC-41
(+)eQC-41
pos
(+)eQC-42
(+)eQC-42
pos
(-)3xSLv1
(-)3xSLv1
neg
A_84_P10000
A_84_P10000
FALSE
tc|TC375586
chr4:2041126-2040951
CTACATTGGTACAAAGACTTATTCCCGGAGGAGATTCCACCCGGACTACCACCTATTCAC
A_84_P10001
A_84_P10001
FALSE
NM_102184 NM_102184 838944 AT1G23350
plant invertase/pectin methylesterase inhibitor domain-containing protein
At.41554
ref|NM_102184|gb|AK175880|ta|TA46278_3702|ta|CD533988
chr1:8293784-8293725
Arabidopsis thaliana plant invertase/pectin methylesterase inhibitor domain-containing protein (AT1G23350) mRNA, complete cds [NM_102184]
GO:0004857(enzyme inhibitor activity)|GO:0008150(biological_process)|GO:0030599(pectinesterase activity)|GO:0046910(pectinesterase inhibitor activity)
AGGAGGTCAACGTCATTTATAAATCCGCCGGGGTTTTGTACCGTATGGCTGATAATTGCT
A_84_P10002
A_84_P10002
FALSE
NM_116719 NM_116719 825818 MSRB4
peptide methionine sulfoxide reductase B4
At.33960
ref|NM_116719|tc|NP13350399|ta|N97075|tc|TC392188
chr4:2442153-2442212
Arabidopsis thaliana peptide methionine sulfoxide reductase B4 (MSRB4) mRNA, complete cds [NM_116719]
GO:0005829(cytosol)|GO:0008113(peptide-methionine-(S)-S-oxide reductase activity)|GO:0055114(oxidation-reduction process)
GGGAACAGAAGAATATGACAAGTTCTTTGAGGAAGGAATCTTCAGCTGCATCGGATGCAA
A_84_P10003
A_84_P10003
FALSE
NM_116748 NM_116748 825853 AT4G05090
putative PAP-specific phosphatase
At.33920
ref|NM_116748|gb|AK175301|ta|TA43475_3702|ta|CNS0A2VL
chr4:2611532-2611591
Arabidopsis thaliana putative PAP-specific phosphatase (AT4G05090) mRNA, complete cds [NM_116748]
GO:0004437(inositol or phosphatidylinositol phosphatase activity)|GO:0006790(sulfur compound metabolic process)|GO:0008441(3'(2'),5'-bisphosphate nucleotidase activity)|GO:0009507(chloroplast)
AGGCTCATTTTTCCGGCGGGCGGTGTTGTAGTAAGCAACGGAAGTTTACATAATCAGATT
A_84_P10004
A_84_P10004
FALSE
NM_116765 NM_116765 825874 AT4G05260
ubiquitin family protein
At.54160
ref|NM_116765|tc|TC379214
chr4:2694314-2694373
Arabidopsis thaliana ubiquitin family protein (AT4G05260) mRNA, complete cds [NM_116765]
GO:0003674(molecular_function)|GO:0005575(cellular_component)
TAAGGGATCATTTAGATCGGCCTCAAGATGGTGATTATTTCTTCGTACACAAAGGGAGAG
43663 18894 Kbytes .Supplementary data files not provided
Less...
More...